Description :
From Genome Similarity Track
Location :
Scaffold_4:218678- 229322
Transcript NameFunction/comments
Phyke_g460hypothetical protein PHYSODRAFT_445341
Phyke_g461U3 small nucleolar RNA-associated protein, putative
Phyke_g462hypothetical protein PHYSODRAFT_343929
Phyke_g463hypothetical protein

Sequence
10644 bases(100 bases per row)
CTTCTCCCGGATGAATTCCGCTCCATCGGGATGGGAGTCACTTTCGGCACGTTTTGGCTTGGAAGTGCGTTGGTGAATCAAACACTCCTCTCGGTCTTTC
ATACTATCGGAACTGGTAATGCTTTCCTATTCTACACTACGCTCACCGCTGGCTCACTTGGCTTTGTCTACTTTAAGGTTCGTATGTATGGTACTCGACT
ACCCTCTGTCTGGTGTACAAATTAATTGTTATGCCTCATTCATTTTAATGGACAGGTGCCGGAGACCATGGGACTCACGTTCGAACAGATCGGATTACTT
TTTAGCGAGCACGTTGCCCATACACACAACGTGGTATGACGATAataacaataacaacaagATAAGAGACGGGCAACCCGCAGTGTATCCCGGGTCGGTA
TCCCGAAAGTCGAACACACGGCAGTCTATTCATCTGAAGCCCCATAATGGGGTTTAGCAATAACCGTGGCGACATATTTCGTCCGTTGCTCTAAATGCTT
GATCACGTGAATAGCTGCCTTACTGTTTCGTCCTTTGCCATTGTTTTCCTAAGAACGAACAACACGGATCTAAGACCATCACACGTGAGATCTGTATGCT
TACTACTTATTTGAGGCGAGTCAATGCTGGCGTATGAGGCCACCTAGTGCACACTCATTGACCATTATCTTGTGGCTGTGGTCGTTGCTGAGAGTTTGTT
AACTTCACCGTCACAACGATACAGTTGCCACAATGGGACGGAAGTGTGTGATTCACGTGAAAGACATTAACGAGGTGAGCACGAAGTTGAAAACGATATC
GAACGACCCACCTGCCAATGCACCATTCATCgaccaagacggagacaCTTCTTGGGGTCCGGTTATCTTGTGTGACGTGGGAAGACTTTGAACGATGGAT
CGATAACAACTTCGGACGGGTGCGACGGTGGTGCTTCGAGCCTTCCGATGATGGTACAGGCATGGGGAGAATGGTCATCTACAGCCTTCCGTCAGGCGTT
CACGAAAGAACAGCAAACACGATTGAGCAGTTAATCATCTCACAAATCCTACGGGCAGGGAATACCATCGGCACTGTGATTCCTAGAAGACTCATTTGTG
TCATCAGAGATTATGGTCAACAACCTAATCGGAGCTTGACGCCTGTGGACCTCACTGTCGGAGGAGAGGTATTGGCGGCTGAAGGCGGCTTCCCATTTAC
AAATGTCGTCATTAAAGCTGCTTACAGGAACGACGAGTTGATGAGACTTCGTGCTAAACTTGAGCGCTGGATGGATCCAAGGTGGACATCTGTGCAAGTG
ACGATCGGAATCAAGATATTTGCTGATGGAACTACTCCGCTGCGTCGAGTTGCCATTTTACACCAACGTGGTCAGTCCATTCAAGAAGTGGAGTTTGGAC
TGAATTGTCGGCATCTACCTGCGTTGGTGTTGACATTCCCACTTACAACAGTTTACTTTGGCGTTGCTCTACCAACAGCTTTGTCTGGTCTCGACAACCC
TCAAGTCTCTATTGACCTGTTTGTCTTGCGAGCAATGTTTGAGACCTACGTTGGAAGAGAGGTTGGTGCTCAGCGGGCAGATGAATAGTCTGCAATCCCA
GCTTCGATTGCGTAGATATCGGTTTGATCTCCTTGCTTTCGTGGCCAATAAGACCGTTAACAATCGAGTCACCTTAGTTGTTACAAGGACTGCCTTGCAA
TTTGCTATTCAAACCGTACACACGTCACATGGGACACTGCATTTTAGATTCGGGATAGGCTCAGTTATCGATTTGCGAGGACATCATGGACGGGCTGGAC
AATGACGTCCTATCATcgactcagcagcagctggaggagctcgagTGTATGCTCAGTATGTTCCCAGATGCCCAAGAACTACGCGTTGACTCAGATGCAA
AGCAACAGCTTGAGGAATTTGCCACCCAAAGCCACGGACCACGTCCTGATCGTCGAATCCAGTACACGCTTTCCTACAAGGTTGTAGCAATTGCATAAAA
TAATTGATTCAAATGGTGTCGACACTAACAATCGCTGTCTGTATGCTTGTTGCAATGCAGGATTTAGCCTTTGGACGACAGGTGCCGGTCTTAACTCTCA
CGTGTCCACTGGGATACCCCGAAGTCGAACCGATGACATTCGAGGTGCAATGTCCACAGCTTTCTCGGATAGAAATGGAAAAATTGCAAACCGAGTTGTT
GGAGTTGACAACAActgcttgtgcagctcatGAGGTGGTGGGGTTGCAGCTTTATCAGCAAATGCACGAGTTCCTGTCACAGGTGCAGAGTAACAGAAGC
ATCAATGAAGGTCAAAACGAAGACACTGCTGTTGAGGTTGCGCCGACAAAAGTAGTGCTGGGTCGACGTGCTATCTACTTCCACCACATCATTGCATCAA
ACAAACGTCGTGTGGTGAAGGAATGGGCATTAGAGCTACAACTCGGCGGGTTTAGTAAGATCGGTTGGCCAGGTGTCGTGATTGTCGAAGGAGCAGAAGC
CAATGTGCAGGAGTACGTGCGTCGACTACAGCACCTGCGCTGGAAACAGATTACTGTACGTGGAGAGCAGACAGAGTCAGAGCATTGTTCCTCAGAGGGG
TTGGACACAATGAGGAGGTTACCGTGCAACTTTCACGAGTTCCCAGAGAACGGCATGTCTGAGCTCGCGGCTGCTTGTCGGGTTGCTGGCCTAGAGGACC
TTTTTCTCACTACCATGAAAATCTACGGTCGATCAGAAGACAAGGAAAGCGACAAAAACTCTACACAGGGCAGAAACCAAAAGAAGGGAAGCCGAACACT
GGGATAGGGAGTAGATCAACATGAAAAGCACCCATCGAGGCATCTATGAGAGGGATCTATTTACACTCGttgcttcttctgcttcttcttctttccgacc
gcagcagatggagatTCCTTGCCACGCTTTCGGAGCTGCTCTTTGACCTTcacgtcttcatcttcaacgacTACTGCTTCACTATCGCTATCTGTCTTCT
CGACGGCAGACTCACTTTCGCCAACTGGCAGCAAATTCTTCATAGTCACAATGCTGAAGTCCACGAGATATGACTTCTGAAGCATACGATCGATGCGCTG
GAAGTGACGCTCACTGTACGCAATAAGCGCCTCCAGCGACTTCGATACACCGTCCAATGATTTCAGGCGGCTCGGAGGCAATTCTCGGAGAATAGTGCTC
ACTAACACTTGGCAGACAGATGTGTGTCTGGCATTTGTGTTCCAGTCGCGCGACCACTCTagcagcgtcgtgagctGAGCGTCCTCCAGACTGTGCACCA
CTGGAGCGAAAATGTCCTCGGGCGCGAAGGAGTCCGGGTTAATTGCCTTACCGCCTGGGAGCACCGGCTGGTCCTTGTGTCGTGGCCcttcaagaagatc
acgcaAGATCTGAAGCATGCGGTTTGGGTGAGCAAGCTCGAAGGCGAGCTGCACGGCATCGAGGAGTTTGTTATTGCGCAGACAATTGAAAAGTTCCTGT
tctttcagcagcttcgcgtcacggtcatcttgctgtgaacgctcttcctcttccgtAAAGTCGCGCCAGAGATTGATCGTCGAGTCCGCGCCACCGCTAA
CCATCTCAGAGCTATCCTTGGACACAGCAAGAGCCCAGATCTTATCCTCGTGGTTATCCAGCGTAGCCTCGCATTCGTTGCTCTTAATAGTCCAAAGCTT
AACAAGCCCGTCAGCACCCGCAGAAAGTAATTGCATGCCGGCGCATGCAAATTGAACATTCAGCACAGAAGCTGTGTGGCCCTCGAAGGTCTTTAGGCAC
GAGAAATCCTTGGCAGACCAGACCTTCACAGTCTTATCACCACTTGCAGATGCCAGACACTGATCCACAGGCGAGAACTCTACAGCCCACACTCCACGCT
TGTGGCCACGGCATACACCAGCCAACGTTAGGAGACGGCCCGCACCCCCCTGCTGAGAGTGCCACACCTTAATAAGCTTGTCCTGCGACGCACTAGCAAT
AAATCGGTCGTTAGGCGATACCGCAAGGGAATTCACATCCTTGTCATGGGCCTTCACAGCACCCAATGTGGAGATCGTCAACTCCGTCGGCGCAGGCTTC
GCAGGTGAAGCGTACGCACCAGCAAGTGGCTGGAGGCTCCACATCTTGAGAGTTTTGTCCGAGCTGCCAGTCACAAAGAACGCAGCGCCGGTAGCAAAGC
TTGTAGCGCGTTGCGAAATGGCGACCGCGCCGAGTGACTCCGTGTGTCCAGTGCACACAGCCACACAGCGCGCATAagtcttgctcttcttgctaCCAGC
TGGTCGCAGATCCCAAAGGCGAGCGGAACGATCTTTAGAGGCACTCACTAGCCATCGGCCGTCCGGGGAAACAGATAACGCCATCACGATATCTGTGTGT
CCCGACAAAAGATCACACGACAACGTGTTGCGGTTAAGAAGACGAATCTGCTCGCTGTTGGTTGCCGCCGCTAACATATCCGACGGTGCACCGCTAGCGT
CGGCCTGCGGAATGTACTTCAGGTTAAGAATATCATCGTTGAAGCCAATAATCTGCGTGCGGCGCGACAGTTTTTCGTCAAACACCAAGAAATTCTGCTC
CGaggacaccaccacgatcTCGCGACGTGTTGCACTTAGCAACAGGTCGGTATAAGTGAgggctgaagaagcaccaGATTTCTGTGTGAACAATGTCTCG
CAAGTGCTACCGCTACTGCGCCACAAACGCAGCGCGCCCTTATCTCCAGCAGTCACGAAGTTAATTGCCTTATCATCCTGAGGCTtgccagcagctgcag
tggtaACGCACTTGAAACTCTTGGGCACAACCACAAGCCCCTCCACAGACTCATGCATCAGCACCGTCTTGCTCAGTTTGTGATCTCTCAAATCCCAGAA
GTTGACAACCTTGTCACGTCCAGCAGACAGCATCGTATAGCCATCTTCCGAGAAGTCCACGCTAGTAACCAGACTCATATGATCTTGAATACATGCGACC
TGTTTCTGTGAGTACAAGTCCCAGACTCGCACTGTGGCATCATCACTTGCCGACACGAGCGACAATCTCGCTGCATCTGGATGAAACTTGACCAGTGTCA
CAATACCCGAATGACCTCGGAAGTTGTGCGTGCAGTAGCCCTTGTCCACGTCGAACACTTTGACGGTCCTGTCGCTCCCTCCGGTAGCCAGCAGCGTGCC
TGACGTGTCGAAACCCATCGCCAATACTGGCGTTTCATGGGCTTTAATTGAGCGAACACAGGTGAAAGTATCTAGGTCCCACACACGTAGTAGTAGGTTG
CGTCCAGCCGTCACGAGCTGATTCTTCTTGCCAGGacgcacagcaaacactACGAAGGCCTCCTTcgcctcctcgtcctccacaTCTTGCTGCAATGTAC
GCTGTAGTTCACCAGTCTCTGCGTCCACAATAGCCACGTCGTCGTGCAGCATACAAGCCATAAGAGCGCGAGGTTCAGCATCCGACGAGGTGCGACCAgt
gaagagctcgacttTTCCGCCAGTGTACACGCCCGAGTGCGTCTTGACAGTGCGCCAGATCTTGGACAGACCCGAGCGGGTCGAGTAGCTTCCGGACGCA
CTCGCAGAACCCTGCTCCATTGTCGCCATCAGTACGAAGAGAGTGGCAGGTCGGTTCGGATGTGGCGCTTTGGACGGGAATATGACTGGCACCGACGCAA
AACCTGACCAATCGAATATGGTATGAAATAAAGAGGATAATTGTGTGGTCCACCTTATTTCGGTGTACGATAGACTAAAACTGTGCAATGTGCCATTAGG
TTCTGGTCCTGCGACTATTTCTAGTAATGTGCAATATACTCTCTGAGTAGTAGCGGATGATTGTCTGCTGTGCTTCATTTGGGTAAGAGCACTCGCTACA
GAACAGACAATGAGTCTCTGCATAAGCTGCACATGCAACTCCGTCTTCACTGCACCGGACGATCAAAGACCACACAAGCTAACATGCGCAACGACAAATT
GTCTACGAACACCTTACCACACGACATCAACATTAAGCCACAGAATGACAGCATTTTAGAACGAAGCCTTCTTCGAAGTGGATCCTTCGTCATATAAATC
TTACAAATCGACCAACAGCAGGCGGAGCAACAACTCTTAATCGAGTACGCGGACTTCTCAGCTTTACGACATGTTTGACGCATATCTAAATCACAACTCA
CTAGCACTCAAGCCCATTTTTCGGTCGCCTATGGTCGTACACAGCAATGTGTTAGTTCACTATGATCCACTGGGTAATGTGTTCATATTCGTGATGAAAG
AGTGTTCGAGAGCGCTCTGGACACCGCACGTTGAAGAGGCCTGGCGTCGACTCTACGgtcactgctgcatcatTCTTACAGACGAACACTGGAACAGTAT
TCCAATGCCCATAATATGGCAGACACAGGCAGCAGTCCTATGGTTGGAGACATACATGGCAGCATTTGCCAGTATTCCATCAAGGAAAACTCGACCGCAC
CGGCAGGCATCACGACAGATAATAGCCTTAGAGTGAACTAAACGGCAGTATAGATTTTACCGCAGTAGTGCGTGAATCACGCGCCGTGATCCAGTTAATA
ACACAGTTTCTTTGGCATATTTTCAGCGCTACCGTACTAGTAATCGTGATAGCGCTGCAACGAGACTTCGGAAAATTTTGTGGGGGATGGTATTGAACAG
AACCAGATAATTCATCGTCACCCTCACCAGGTTCAAGGACGAGTGCATATGCATTTAGCTTCGACTAATCGACGCTGCAACATGTCCAACCATGGTTTGT
TCAAGCTGAAGGATGCGTCAGCATCTTATCTGTTGCGCTACCTATGCTACCACATTGATCCACTTGTAACACCGTCCGCCTTGACTTACCACTTGTTAAC
CATACTCCGACTCATTTCGTGATTGCATCTGTAAGTACCACTACAAACAACAATGGGTGCCGCCGCGAGCTTTAGCGCACACCACGACGTGCCGAAGCGG
CCCAAGTTCTCCAAACGATATTGCCGCATCATTAAGCGCTATTTGCCACACTTTCCGATCACGGAACCGTCCGGCAATGACGATCGGCTCACAGCCTTTG
CGCATTGGGAACGTGTCTTCAAAGAGAATATTCACATGGATGCACACCATGCCGTCGGTTCCGGCACCAAGATCGGCCTTCTTTACGAGAACTTCTACAA
GTATCTCTTTGAGAACTACCCGCACATGAAGCCTCTGTTCCAAGCCTCGGTGCAGATTCAAAGTCGAGTGATCGTACATATTAGTAGTGGCATGAAGTCA
CTGCTATCCTCTGAGGACCTTGTGCAGAAGGTCATGAATCTGGCGCTGGTACATCTCAAGATCGGTGTCAAGCCTGAAGATTTCGACCCGCTGGGTGACT
CGCTCGTGCAGGCCATGCGGCTCACTTGCGGCGGTGACTGGGACGAAGCCATCGAGAACGCATGGAATCATATATACTGCCACGCCGCCATCCTGATCTT
AGTCAACATTCCTGACATCGACATCAACAGCGATGACGATTAACCCTGAGGTGACAAAGGATAAAGTAAGCATGAGGATGGCATTATAGAATATATCGAT
TTCAAAGAAATGGATGGCGCATTGCATTGTTTAGTTGCGCACAAATATTGGCAGTTCACGACATAATACTTCAGTCATGGGTGCTCACTTCCTTTCTTTT
TCTCCTTGAGCATTTGAATTTCTGCTCGGAACGCTGGCTTGGCCAAATCTGTGCAGCGCTCTCCATCTAGGTTCTTTGCATTCGGATTAGCCCcgttctc
cagcaagaaTCGGGCGATACCTTCGTAGCCTTCGGTAATAGCCAAATGCAATGGTGTGTTACCTACACAATTCAATTAATTAAGTCACCGCGAGTCCGTC
AGCACAGTAATTCAAAAATCGCACAATAGGTAACGATAACAACTTGCCTGCAATATCGCGCGTGTTGACTTTCGCGCCGTGATCAAGCAGAAGAGCGATA
ATTGCTACAAAATCAAAAGGTAGACCACAACAGTTCAGTccaaaaacaacagcaaatgaTACAGAACGGCTGAAAGCATTGCCATCGAACCTGGACTCGG
TTTGCCGCCCAAGGCACGCGTCAACGGCGTACTCCCGACATTGTCCTGTAGCAAATATTACAACACATAAATGAAATAAATGCACTGACACACGAAATAT
CCTTCCAACTCCAGGAATGGGATTAAAAAGCCATAACGCACTGCTTGGTTGGCATTCTGCGTGTAGTCCAGCAACAATTCCGCGATTTCTTGGCGCCCTG
TTCGCAAAAGTATCATATACGTCAATCCAGCTTGTCCTGATTGTACATAATGTTCTAATGCAAACTACAACTGTCATACCTCGATGGTAGTGCAATGGAA
TCTGTCCGTTCTCATTGGCGAGGTTCGCATCAGCTCCTCTACGTTAGAGTGCAGATATCATTCAGTCaggccaagatgcagcaattcCTTGAGTAACCGA
ATGCAATGATTTGTCTCCCTACttgctcagcagcaaacccACAATGTCCCCGTGTCCAGCGGAGGCGGCACTCATCAATGGCGTCCAGCCAGAGTCGTCC
TGGACGTTCACAGAGGATTTGGCGTGTTCGAGAAGGAACTCGGCGACTTCCAGACGGCCGATGGCGCAGGCCCAATGCAGTGGCGTGCGctcatcctcgt
ccttgagATCAAGATTGGTGCCAGCGTCCAGAAGTGCACGCAGCTTAGGAACGTTGTCGTCATTCACGGCAGCACAGGTATCGGTCTCCATCGTCGTGAG
TCCGCTTGGTACAAGGTCAAATATCTAAAATCTAAAAATATTTACTGATTACAAATCTAAAACCCAAGTGACTCGAATTGAGTCTCTCAGGTATCGAGTA
ACCCGAAAAAGTTTTTCCTTGCCATGTAGCAAATGATTGATGTGTGGTGACATTACAAGTTTTGTCCAACAAAGCTCAGTGTTATTTCGCTGGAGTTATT
GCAACCAACCGTTCGCTAAGCGGCAGCGATGGCAAGTATGTGTGTGATTCACGTGAAAGACATTAACGAGGTGAGCACGAAGTTGAAAACGATATCGAAC
GACCCACCTGCCAATGCACCATTCATCgaccaagacggagacaCTTCTTGGGGTCCGGTTATCTTGTGTGACGTGGGAAGACTTTGAACGATGGATCGAT
AACAACTTCGGACGGGTGCGACGGTGGTGCTTCGAGCCTTCCGATGATGGTACAGGCATGGGGAGAATGGTCATCTACAGCCTTCCGTCAGGCGTTCACG
AAAGAACAGCAAACACGATTGAGCAGTTAATCATCTCACAAATCCTACGGGCAGGGAATACCATCGGCACTGTGATTCCTAGAAGACTCATTTGTGTCAT
CAGAGATTATGGTCAACAACCTAATCGGAGCTTGACGCCTGTGGACCTCACTGTCGGAGGAGAGGTATTGGCGGCTGAAGGCGGCTTCCCATTTACAAAT
GTCGTCATTAAAGCTGCTTACAGGAACGACGAGTTGATGAGACTTCGTGCTAAACTTGAGCGCTGGATGGATCCAAGGTGGACATCTGTGCAAGTGACGA
TCGGAATCAAGATATTTGCTGATGGAACTACTCCGCTGCGTCGAGTTGCCATTTTACACCAACGTGGTCAGTCCATTCAAGAAGTGGAGTTTGGACTGAA
TTGTCGGCATCTACCTGCGTTGGTGTTGACATTCCCACTTACAACAGTTTACTTTGGCGTTGCTCTACCAACAGCTTTGTCTGGTCTCGACAACCCTCAA
GTCTCTATTGACCTGTTTGTCTTGCGAGCAATGTTTGAGGCCTACGTTGGAAGAGAGGTTGGTGCTCACGCTGCGGCAGGCTGACGAGTAgacatttttg
ttgttgttggtttgCATGAAGATCTGAATTTACTGCCTACAAGTGTGTGCTTCTAGGCACAGAATCTTTAAGGTGGTACGTCTTGAAAAAAATCAAGTTC
CTCGCGTATGATAATTTTTTTTGCGGGTCATCTTAAATGGCCGCATGCATCTCTGGCACGTCAAATGGAAGTTTTGGAGCACCATCTCGCTAATTTTTGC
CACATTCCACCTCATCTGGCAAGAACATTGTATGGAGCTCGTTGAGCGCCTCGCCAAGGTCGATTTGTTGCTAGGTAAAATTTGAGCCAGTTGTGGACAT
GCAATAGTGACATACTTTGAAGTAAGAGATAGAGTCTTCATTGCTAAGTGGGGTCCTTGTGGCAAGTATTATTACAAGGACTTCCTGGTACTTAGTAAGA
TGACTCGACTGCTACCTGTCTTATTAACCGTGAAAGCAAGGAGATCAAACGTTAAACTTATGATCAACCAACCTAACGGGCGAGGCATGCCTAGGCCGAG
TCTCAAGTCTTCGCGCTTGTTCTGCCTGTGCGACGAGGGGGTATTTAAACCGTAATGTAATGATATACAAAGCAGCGATGGCAACAGATCACACACTTTC
TTCCCATTGTTGCTATCATTACGGTTGCTGTTACGACGCAGGGAAATAATGAGAATGAAGAGCTGGTCGTCTCAGCAGAATTCTCCCAGCAAACGACGAA
CGCACACTACCCGCAAAAACAATAATACAGAGCGACATGCCTGG