Description :
From Genome Similarity Track
Location :
Scaffold_5:218563- 223767
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G002575Similar to Peg10: Retrotransposon-derived protein PEG10 (Mus musculus)

Sequence
5204 bases(100 bases per row)
AAGTTCCTCTCAAGTCTTCCTCTCAAGCGCAAGCGTGTGTGCTGTGTTTGAGGCTGTCTCGGATAGCCACTTACACCTGGTAGCACTTCGTAGTCCTTCC
AACGACCAAGTCAAGAGTCTGCATAGGCCGCTTGTGTAGCGTGCGCAGACATTCCAAGACCCCTGTCCGATTGTGAGAAACAATGGAAGGAATTGAGACG
CCGATGGGCTCGATGCCTGGAGAAACCGTGGAGCTGACGAATGAGCATTTTCCTCATTTGTCGAGCCACGAGTGGGCAGCCCTCGAGCGTATGCGAGCGG
TCATCGGTGAGGCGGCTGTGATCAGCTTGCTGAAATCAGCGTCACCGGATGAGCAGAGGAACGCGGCTACGAGTTTCATGCATCACGAGATCATGAACTC
TCATCGACAGTCTGCAACTCCTGTCACGACGATGAGAGTAGCACCTCTGAAGCTCGATGTATCTCCGCACCGTGGCGGAGAGAACGAGCCTCTAGCGAGA
TGGTTCGTTGAGTTGGATGCAGCGATCACTGCAAGACAACTACGGGACCCAATACAGCAAGTGTTGTTTGCAATGTCAAAACTTGCGGGTCGAGCGAAAA
GTTGGGCGTATGGGAAGCGATTGGCGGAGCCACATTGCTTCTACGACCTGGACGACTTCAAGCGAGAGCTGAAGAAGGCTTTTGAACCTCCGCAGAGCGA
ATTTCGGGCTCGCGCAGAGTTCTTAAAGCTTCGTCAGGGTAAATACGACCTACACTCGTACGCTCAACGAGCACGATACCTTGTGTCAAGTATCGTGAAT
GAGCCGATTGATGCCTCAACACAAGTTGTGACATTCATGGCAGGGCTCAATGATGGTCCAATTCGGAACCAGTTGTTCCGCGAGTACCCCAAGACGCTGG
ATGAAGCTATCGAGCGAGCGATGCAAGAAGAATTCAGCATCAAGCAAGCCAAGTTCGGCGGTTTTGTCGCTCGACCTCCAAGACAACAAGCGACAACATG
CAATGGCCCAGAGCCAATGGACATCTCGTATGCCGATGTGACTGCAAGTCGACAGCCACGCAATGACGGGAAGTGTTTCCGTTGCGGCAAGCCCGGCCAC
ATCGCGAGAAATTGAAAGGTGTCCTTGCCAAGCCAGCAAGCGACGCACGGTCCGCGATCGAATCGACCAGGCAGAGGCCGACAATTTGAGCGTTCCCAAC
AGCCAAAAAACGGGAACGACCAGTAGGAGCGGGGCTCCCTACTGGGCGAACTAAGAGTTCTGTGAATGTCGTGGAAGCGCAGAACTCTTACCCCGGTGTG
TGTAACGCACATGAAGTTTCCGCGAACAGATGTGAGCGTGTCGAGCAAGAGCCAACCTTGATAGTCCACAAGGTTAAGGTAGATGGTTACTCAGAACCTC
TACGGGCTCTTGTAGACACTGGTGCGTCGAACAATTTTGTCCGCACACAAGTGGTGAGAAGGCAAGGTTTGGACCTGCCTATCTCGAACAAGGAAATGAT
CGTTCGCTTGGCGAATGGGTCGAAAGTGACGATGCCTAAGCGCGTGTTGCGTATGGCAATCGGATGTGATGATTCCCGAGGTGAAGACGAGTTTATAGCA
CTCGACCTCGATGACAAGTTTGATCTGATTCTGGGAATGCCCTGGTTGAGAAGGTACCAACCGAGCATTGACTGGAAGAAGAAGAAGATCAGCGTCGACA
AGCAAGTCGACGAAGACCTCGGCTGCTTGACAGCAAGAGAGGTGATTTGGGCATATACATCTGTTGAAGATGTGTCTAATGAGAGTCAGGCGTGCGATGG
CCCCTCACACTCAAATGACAAGCCCGTGAAGACCACTGGAGGTGGAGTAGTCAGGCGCCAGAAAAAGACTACTCCTGTGGCCAAGAGCGATAAAGAGTTC
TGCTCTGACAGGATTAAAGAAGATAAGAAGACCGATGAAGAAGAACGAAGATCTGCAAGCGTCCCTGATCAAGACACAAGGAAGGCAGAAGATGAAGTGA
AGAGGCAGGAACAAGCCACTTCAAGTGAATACGTGAACGTCGTAGTCTACAATGAAGAAGGCGACTGCCAGATAGCGCGTCATGTGCAAGTGGAAAATCC
TCCAAGTCTAGCTCAAGAATTGATTTCCTTGCCGTTGATGAGCAAGAAGACGCTTAAGCGTAGCCTGGTGAAAGGCGAAATTTCGCAAATTTGTGTGATC
GTCGATGAAGTTGCCGGCGATGCTATCAACACTGCGGAAGTGTTAGATGAAAGGACACGGAAGGAAAGGTTTGATGAGCAGTCGTGGGACACTCTAAAGA
CAAACCCCGTGTATGGACTTGTCAAGGAATATGCTGACATATTTCCAGACAAAGTGCCGGACGAATTGCCGCAGGATAGAGGCATTCGTCACGAGATAGA
TGTACTTCCGGGAACAAAGTACTGTATTACAAGGCGATGGCCGCTACCGAAGGAACAAGTCGATGCGATCGATGAGTTCTTCGTGCAGCGACAGAAGGCT
GGCCATGTGCGTGAGAGCAAGTCTCCGCACTGTAGTCCCACCTTTTGTGTTAAAAAGGCCACAGGCGGTTGGCGCATTGTTCATGCATTCAACAAATTGA
ATGATGCGACCATACCTGCTCAGACTCCAGTTCCACGAAAGGATATGATCCTTGATGGAATGGTTGGCAGCACTGTCTTTAGCGCGATCGATCTGAAAGA
TGGATTCTATCAGATTCGTATGCGTGAGAGTGATGTACCATTTACAGCAGTAAGCACCCCTAGTGGTATGCTGTGGGAGTGGATGGTGATGCCACAAGGT
CTGAAGAACGCACCAGCAACTTTCAACAGAATGGTCACGAATGTACTTCGTCCATTAAGAGAGTTTGCACCGAGCTACTTTGACGACATATTCGTTCACA
GCAAGGCCTCGGAAGGGAAGAAAGATGTCGATGTTCATCTTGGACATCTTCGTCAAGTCTTTCAAGTAATGCGTGAGAACAAACTGTACGCTAACTTGAA
GAAATGCATCTTCTACGCCCCCGAGATCCCTGTACTCGGTTGCTTTGTTGGCAAGAATGGCGTTCGGGTCGATCCTGAGAAGGTCAAGTCTATTGACGAT
TGGCCTATTCCTCAGAACATCAAACAGCTACGTCAGTGGCTGGGTTTGGCCAACTATTTGCACAAATACACGCGCAACTACGCAGCGTTAGTGCAGCCCC
TCACGAGTCTTTTGAAGAAAGAAAATGAGTGGGAATGGTCAGAGGAACACCAGGCAGTGTTTGCCGAAGTAAAGAAGAGCTTAAGAGAAGCTCCTGTCCT
AGCTCTCACAGACCATGAGAAGCCGTTCCATGTAGTCTGCGATGCGAGCGATTATGCCATCGGGTGTGCACTGATGCAACACGATGATGAGGGCAAAGAA
AGAGTTGTATCGTATCAGTCACGACAACTCAGGCCCGCCGAAAGGAACTATCCAGTCCACGACAAGGAACTATTGGCCATGAAATATGTATTGGCAAAGT
TTCGAGTCTATTTGCTCGATGAAAAGCAGTTCGCTATTTACACTGATCACGCATCACTGCGGACAGCTGTAAAGACGCCTCACCTATCGCAAAGAATGGC
AAGATGGTTTTCCTTTTTCGCTGAGTACAACTTTGTTGTGCATTATAAGCCCGGCAAGTCAAACATTCTTGCCGATGCACTGTCAAGACGTCCGGATTAT
GATCCGAAGAGCAAGAGTGACGACACGAACGGAGCGTGTCGACTCTGTGAAGACGTCAACACCATTGCTACGGGAGTGACAAGCACAATCCAAGAAGAAA
TTACTGAGGGCTACAAGCAAGACGAAGCATGCCAAGAACTGATCAAGTATTTCAAGAATCCCTCAGACAAGGCACTCCAGAACCTCCCATCAAGAGCAAG
ATCGCGTGTTCACCGTTACAGTATGCACAATGAGCTGTTGTATTATGCGGTTGACGAAGGGGATCCAGCGAGGATCGGTGTCCCCAATGATGAAGGTCTG
CGTCATCGACTCTTGTACGAGTATCATGACAGTCCTTCGAGTGGCCATCTCGGACGCGAGAAAACGTTTCTCAACTTGTCGCGAGATTACTACTGGCCTC
ACATGTACAAGTGGGTTCGCAAGTATGTGCGTACTTGCAAAGTGTGTCAAAGAGTTAAGCCATCTGGCTCAACTCAGGCCCCACTTCGTTCATTACCTGT
CCCTCAGGACAGCTGGAAGTCTGTGAGTATGGATTTCATATTCGGACTTCCAAGGGACAAACACGGCAGGAATGGCATCCTGGTGTTTGTGGACCGATTT
AGTAAGATGGTGCATCTTACTCCGGTCTCAGACAAGATCTCGGCAGAGATGACTGCAAAAGTCTTTGTAGACGTGGTGTTCCGTCTACATGGTCTGCCTT
CGGAGATCGTGTCCGACCGAGACACTCGGTTTGCGTCCAGATTCTGGCGTACTCTGTTTGGCATTTTGGATACAAAACTATCCATGTCAACAGCAGCACA
CCCAGAGACAGACGGTCAAACTGAACGAGTGAATCGTGTCCTGGAAGATGTATTGCGCAGCTATGCGACGTCTTTCGGAGAGTGGAGTGAGTTTCTCCCT
CTCGCAGAGTTTGCGTTGAACAACTCCACGCATGTCTCGACAGGTCATACTCCGTTCTATGTGAACTACGGACTTCATCCGAGAGTGCCAGCGTCACTAG
TAGGCGGAATCTCTACCATAAGTGGGGGAGGGACTATGGCTAAGGAGCCACAATCGGACCTGAATGCTGTTGCCGAGTTGAAAGCCAATTTCGACTCGAT
GAAACCTCTAAACGACATGACAAGTCGTGAGGCACAGCAAGTCGATGATTTTATTGTGAGAAGACAAGCCATTGTAAGGTTTGTTCGAGACGCAATTGCA
AAAGCTCAGATCTGCAAAAGGAACAAGCAGATAAGAGTGGAAGGAAGAACAAGCAAGTATATAAGTCAACGATCTTGTATTACTTAGCACGGCTAATCTG
CCTGACATGCAGTGTCCAACTTGGGAAGTTCGAAACTTTTGCCAGATATATTGGACCGTTCAGAGTAGTTAAATGCATGGGGATGCATACACACTAGACA
TTCCTAACGCATGCGACTACACCNNNNNNNNNNNNNNNNNNNNCATGCGACTACACCCTACGTTCTACGTAGGACGATTAAAGCCTTACCTTCCAAGTGG
GTCA