Description :
From Genome Similarity Track
Location :
contig_35:218550- 224875
Transcript NameFunction/comments
g7975.t1GAY00899.1 prohibitin-2 [Pythium insidiosum
g7976.t1RAW26717.1 hypothetical protein PC110_g16886 [Phytophthora cactorum

Sequence
6325 bases(100 bases per row)
GAGCAGATGAGCGGTTCGTGCGGCACGGCCTACTTCTCGGGCATCATCGGCGGCGGCGCGTACGGAGCCGTCAAGGGCTTTGCGCGCTCGCCCAGCACTA
AGTTCAAAATCCGGATGAACTCGCTCATGAACGGCGCGGCCACACGTGGGTCCAAGGCCGGCAACGCGCTCGGCTGCATCGGTGCGTGGATTTGCGGCCT
TTATGAGTGTTTTCCGAGCAGTTTTACTGAAGTTATGTGTTTTTTGTGCTGCAGCCATGATCTACAAGGCATTCGAGCAGGTGGCGGACTCGGCCGAGAT
CGAGAACATCGTCAAGTTCGACCAGGTGACGCCAATCCTTGCGTCGGCGGCCACGGGCGTGTTCTACAAGTCGACGGCTGGCCCCAAGGCTATGGTGCTG
GCTGGCGCGCTCGGCGCCGGACTTATGTCCGTGGTGCAGTTCGGCATCAAGCCCTTCTACCCGCGACTATAGACGCGCTCTCGGTTTGTTGCTGAGGTTG
TGATCGCAGCGAGCGAGTTTCGAGTCGAGAGATTCCACTCGACTCTAACCAGTTAGATGACCAAGTCGAGCGAGCAGCGGAAGGACAACGTGGAGATGCA
TATGTAAGTTAGTACAGCGGATTTTCATCTTAACCCATTATTCCCCGAAGAGCGTCCTATTGGTACGTAGCCTACAGAGTCCGAGAGGGCTAATGCCTGA
GCCGGCTATCACCCTGCAACCCTCTCCACCTCCAGATAGGCACATGGTGACACTAGGAAACGTTTCTGCTTACGTCTTGTATAGAAGCAAACTTGGACGG
TGCTCAGCCTCGTCATGCAGGTCGCGTGACGTGACATCCGTTGAGTAGCTCTCGAGCCGACGCAGCATTCTCCTCGAGCCTTACATCCGCGCTGGGAGGT
CCGCCAAGCATAGCATTTTTGGATGTGGCGGGTAGCTCCTCAGCCGGGACTCCTTCAGCGTTCCTCTTCCTCCGCATCCTCCTCCTCGCCTCCGCAGAGG
ACGGCGCTTGCGCGGCGCTAGAGCTTGGAGACTGGACGAGTGTGCTTGACGGAGCGAAGTGAAGAGTGAGAGCTTGCTGGAGCAGTGAAGCGCTGCCAGC
GAAGCTGGGTTCAGTGTTGAAGTGCGTACAGGCAGCAATGCGAGGGAGGCAAATTACGTGGATGGTGTACAATATGGCAGTGCAGAGCTTTAGGTTAGCC
TTGAGAGAACTGTACGGACAGACCTTCCCAAGTCTGGACTGGTTAGTGCTTTATACGTTCCTACACGTTGTGAAACAGAGGAAAGTTCATCACATGAGCG
TTGAAGTCCTTCATGACGTAGCACAGGTCGGGTAAATGTAGTCCACACCATAGACCTCTCATTCAGCTTCCCGCGCTTTTTCGCCTCCCAATTGGTTCAA
ATTCAAAACGCCATCGATCATGTCGGCGTCGTACGCGCTGGAGCTGCACGCGCTGAAGGCGGAGCTCCAGAGCACACTGGCGCGTCTAGGTATCGACACA
GTCAGCTCTGATGATGAAACAGACGCTCGGCATCACGTAGACGCCCTGTCGGTACTGGAAATCGCCGCAGAATCGACCGAAACGCGACCAAGGCGGCGGA
ATTCTGGCCGCAATCGGCCCATCACGCGCTGGAACCGCCGTCGATTGGTGCACGAGTTGGCTGCGGCATCCAGTAGGAGGCGGCAGCTGGAGACACAATT
GCATCGCGAGATGGAGAGCGACAGGCAGCAGCAACAGGTCAGCGACGAACAGAGCAGACGCCAAAGCGCGTGGCAGGCGGCGATCCTCGAGTTGCAGCAG
CAACGCGCCGAGATTCAGAGGCAAATGGAGGCAGAGACAGCAGAGGAGATGCATCAGACAGCGGAGAGGGAGCGGGAAGAGCAGGTTTCTGGTGCTGAGG
ACCAGAGTGAGAGAGTGACTGACAGACGACCGACGGTGGAGTCTGTATCAGAGACCCACTACTCGATTGGCGGTGTGGTGACGTTGGAGCCTTTGGCTTC
ATTTCAGCAGGTGCCAGGGCTGGCAAGCTCGAGAAGTGGGGTTTCGATGCGACCGACCGTTGTTACTGCGGCAGCTGTGTCGCCAACGGAAGCTTCAGTA
TCAGCACCAGCGATGGTGTCGGTGTTGGATGCTTATCCTCGCTACAGGAACACGCCGGACGCATTGAGTGACGTGTTTTCGCTGCAGCTGAAGTTTGCGG
AGACGATGCTCAAGCTTGAGAAGTCGGTGCAGATGCGTGATCGGCTGCTGCATCATGGTGGAGCCTTGCCCAAGCATCGTACAGCTGCATACAATACTCG
ACAAGAGAGCCATGCACGTCGTCGTCATGGTCACCAGTCTGTACATCGCAGAGCATCATTTGAAGGCAATTCCAACAGCGACTCTAGCGTCATGTATAGA
GAAACGCATCGTAGTGAATCGTACAGCTCCAGCGTGTATTCGCCTTCGTCACTGGATTCAACGCCGCGACGTGGCGAGACCATTCGAGTGAGGTACCCGA
ACTTCGGAGTATCAAGAGCAACCACGGCTGAAACACTTGCACCTTCCTCGTCGTGCGCAATTCATTCGCCTAGCTTGGACACGACAGGTGGAGGTGCGCC
TGCATCCTCCACGACAACTTTATCACCTCAAGAATCGCCAAGCGCACAAGATGCTGCTGCGCAAGGGAGCGACGCGCAAGGCGAGCTTTCCGAAGCCCGG
GACGAAGAGATTCACAGGACACCCACCACCGGTAGTAGTGTGACTACCCCGACGACTGGGAGTGATCAGAAGTCCAATGCGTCATCGAAACAGGTTCGCT
TTGGAGATGATGCGTATTCGACTCCAGTGCTTGCCCGTAAGTTCAATTTCGACAACCCGTCGATCGATGAAGATGATTTCGAGGAGAAGACGGAAGACGA
GGAGAGCATCCCGAGCTTCCTCGGTGGATCTACCGTTACCAGTGTCGAGCTCAATGACGCTTCATTTCTTCGAGCTTTCCAGCGCTTCCGTCGCGAGTTG
AAGGTATCAGAGCACGACTCTTGCCTGCAATCACCGGTGCTAGCGAGGAAGCTTTTCCCAGCATCAAATATGGACTTTCCTTCCTTAAATTCTGATGATG
AAGGCGCGAAAATTGATTTATCGATCTCTGATGGAGCGACAGGCGACAACTTTGCTCAATCTGCCAGCGCTCCTGTTGAGGAGCACGATCAAACAGCAAG
GTTTCCTGGTCTCAGCGGTTTGAGTGTAGAAGAGTTACAGGAGCGTCGGAGGCAACTCTGCCTTGACATCCAGGCGGCAAGTGCCCAACTTGTGCTAAAC
TTTGGGGCGATGCAAAGCGTAGCTACTGGGTCTCAAGGTGCAGACCTCACGAAGGACTGTTTGCTTGCATTACGAGATGAGCTCAAGGCCGTCGACTCAC
AGATTAGGGAATTGCAATAGACGGTACGCTTGTCAAAGTCTCTCTCTCATTCCAGAATCTGCCGTAATGGTGGCCGTGACCGTTGTCTGTTGCATCGTTG
GAGATGGGGACGTGGCCCCGTTGAGATCGAGTCAAGCAAGTTGTGGGCTTGTTGAAGAAAGTGATGGCAAGAAAGCTGGACTACACGGGGCAGGACTACA
AGCTGCAGTTCTTCCTGGCGAAGACGACGGGTGGCGCGTGGTTGATGTCGGATGACCCTGATGTGATTAGTATGCGAAGTGGAGCCACTTGTAAGCGAGT
GAAGAACCTGCTGAGTGAAGAAATCGACCCAGCAGAGAGATTGGCGTCTTGTTTGCGAATGCTCTGACGAAGAAGACGATTCACGTGCTGGTGGTGATTC
CGGAGGGTGTTGGAGGTCCAACGTTATTGCAACAAGTGAATACCGTCGTATGCGAGGGTGTCGTCTGGTATGTCGTGAAGGGATCGCATTGGTCTCTACG
ACCAACGAACGCTCTCTCGCGAATATCATCGACCGACTCAAAGAGGTCTATGTTGTGCTTGTCAAAAGTCCGCCAATGTCTGGGAAAATATCGCTGGCGA
AGTTAGTGAGCTCGCTTTGGCCATTAGACGCAGGGAGGAACAGAAGAAGGCGGTTGAGTTCAATTTTTCGGTTTTGGGGATGTCCGAGAATCAGACTTTC
GAGGACATATTCGAGGAGTGTTGCAGGGTGCCGTGGAAATACGCAAAGGTGGAGCTCCCAGCGCCAGACTGCGTGGTGTACCTGGTACTGGACAAGACGT
AAGTGATCTACCAAGATGACAATACCTCCTCCCATAGACACAAATCTAGTGGTGTTTGGGAGCTGGTCAAATTTGTTCTGTTTGATACCATACAATGTGA
GAATCTTGATGTTTTCGCAGCTTATGGCTCTGGAGTTGAATACTCTCGTTGAATACTCTCAACTCGCTAATCCAATTTTGCTTCGACGAACGAATGGTGT
TCGGGGTCAAAGAACTGGATTTTAGTCGTGCCGGAAGTCTCTGAGTGCGTCGCCAAGTGGTTCGAGGACTTGGTGAGGAAATGGTTACAGAAGTTTGTTA
TCGTCTTTTCGACGCTGTGACCCACGAAGCGATCCCTGGGACCCAGACAGCTTCTGTGAAACGAGTCGATGATGTCCAGGATATTGAAGATCTCTGCATC
AAGATTCGTGAGCTTGCCGACGACCATCAACGACCACGCAGAGACATTCTAGCGAATGTTGCGCTCATGCAGATGAAGGTGCACCGGAACAGGGCGGCAT
ATGATGCAAAGCGACGGTCGATACCATTCACAGCTCACCTGAACGGGTTTAGAAAGGATGGGGTTAGTGCGCTCATTGTCGAGGAACCGCTACCACCGAG
GGAAAGAGACGTCTACTACGAACTAACAGCTGCCGACGGTGGTCTCGATTTCACAGACACTAAGCATCTTCAGTCCGTCTAACGAACTTGAACAGCATCG
ACGACTTCAAGAAGAACGTTTTGGACTTGAGTCGCCCGCTACTCGCCGAATATGCGCCACATCATGTAACTGTTTATCCGGACCGGGAAACGAGTGGCGC
CTTGGCGGTGGATGCCAGACTTGGGACGTATGGTGCATCAGCCGCGAAGGCGCTGGTTGTGAAAGTGCCGTCGCGACCAAGTAGGCGGCTGAAATCAGTG
TGGCATCAGACGGTGACACTTGACCCTGCTGCTTCCAGACTGCCGCTCGGTGAGGAAAGCCCAGTGTGGAGAATTGATCCGACTGCTATGGTTGGTTTTG
GTATTTATGAGCTTTGCAAGAAGTTGTGCTTGTACTGTCGCGTTGACACTGTTAAGTTGGCCCGCTTCTTGCAGATCCATTGTTTTGCGGTAGCACCTCC
AGTGTGTGTTCTCTTGGAAGGAAACGAGAAGATAACAATTTAACAGGAGGAAACAAACTTACTGAATGACATGGACCTACTTCTGAATGAAGTTGAAGAT
ACAAAGCAGCACATCGTGTTTCTTGATGGGGTTACACAGGAACAGGACCAGGCAGTGCGTGTTTGTATTGGCGCGAGGTAATTCTGCTATCGAAATACTA
CTTCGCTGGCGGGAATGTTCGCTATATGTTTCACTATCCAAAAGCGCAAGTGATAAAACCCCTGGATGAGGCTGTCCAAGCCGCAGTGGGGACCCCATTG
AGGGAGCGTATAAACACAGCTTCCTCATCGGTTACTTCAAGAAACTTTTAGACTCGCTCGCGGCAGCGATGTTTGAGGTCAAGACGCTGGAAATTTTCTT
CGTTGTGGAAAGGCAAAAGCTGCTCCCTTTCAAGTTTTCCGTGGTGACCGGTCAAGGAAACGTGATATATTATGGATGGCAGCAGGGCGAGGAAACAGGC
AAAGTGAGGCGTGTAGCCGTTGAAGGGGTCGAGACCTGGAATGTATTGAATTGGTGAGCAAGGACCTTAATGACTGGTACGGAATGGCCTTAGCTTTTTG
GCAAAGGACACAGAAATCGTTGAAATTGATTCACTATTGTCGGACTTTTAACCTTTAATCCTTCTACATGGAAAAGCTGAGCTCCAAGTTGCTTCACGGG
GTCGAATTCTTCAATTACATCGATACGAGAGAGTATGTGAAGTGCTTGAGCAACTTCTAGCGATTTTTGTGGAGCTGACCGCTTGAAATGCGTCTACTGG
TCCTGCTCCTGGTATTGACACCTTGTACTAATGTCTGGCACGAATAGTTTGGGCTCCCAGGATTAGACTGGAAGATGTCGGTTGCAATTCAGAGCGGCAC
AGGAGGTGACGAGGTTGGCGATGCGCGCTTGCTCTGCCCCTGCTGGCCTCCTTCACGCGTTCAACCAAGTATCGTCAAGAGTTTGTCGGTCACGGAACAG
AGTTTCGACTGCGTGCCACGATTAT