Description :
From Genome Similarity Track
Location :
Scaffold_67:218549- 219688
Transcript NameFunction/comments
g10538.t1POM58039.1 LOW QUALITY PROTEIN: Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
1139 bases(100 bases per row)
TGGAAGATGAGCATATTCATCACCACGAAGCTGGTGATCTGCTAGCTGAAGATGTGGAAGGCGAGATGGCAGTATTGCCAGAGATCACGGCTATGACGAG
CGAAGTGACTATTGACGATGTCCAGGTGGGTGATCCAGATCGCAGCACTCCAGATGAGATCGATCGTCTGCGGCAGATCATCTGGCGGAAACGACACTTG
CTGATAGGCAAAGGTAATGCCTTACCGCCAGCTGCCCGAGGAGTCGTGTGTGATATCGATGTAGGAGGTGCGAAGCCGATCGTGCAACGGGTGCGGAAGA
TAGCACCGCAGTTCCGGGAGAAGGTGTCAGATCTGATCAAGGGGTTGCTGTCAGCAAAGATGATTCGACATTCGACATCGCCGTGGGCATCACCGATCGT
GGTGATCATCAAAAAGAACGGGATCGACATCAGGCTATGTATAGACTACCGACTGGTGAACGGTCTCACTCGACTAATGATCTACCCCATGCCTCTGATC
AATGATCTATTAGAGGATCTGAACAAGGTGTTATGGTACTGTTCGCTGGACATGGCAAGCGGATTTTGGGTCGTACCTATGACGGACCGAGCTCGTGCGA
TCTCGGCTTTCATAACTCCATTCGGCTTGTTCGAGTGGAACCGGATGCCTTTCGGACTCAAGAATGCGCCTCAGATCTATCAGCGGCTTCTGGATAACGC
GTTATATGGGTTTACACGGATCCCGCCTACTGACGAGCCAGGACTTGCTCCAGATCCATTTGAGGCTGGAGAACCGGAAGATCCAGGCCGTCCGTCAGTG
TTAGGACGCAGATCCTACATCGATGACATCTTGGTAACAGCTGGATCTTGGGATCAACTGTGCCACCGATTGGAGAATCTGCTCGAAGCGTGTGATAAAT
GGAACCTGTCTATAAGTGTGGTGAAGAGTTTCTGGGGTCTTCCCCGGGTGGAATACCTGGGACACCGAGTGTCCAACGATGGCATCGAAGCTAATCCGAA
GGACTTGAAGACTTTGACGGATCTACCTTTTCCGGGATCACTCAGATCCATGCAGTCGTTTTTGGGCAGCCTGAACTATTACAGCCGATTTATCGAGGAC
TATGCGATCTATGCTGCCGTTCTATATGAATTACGCGAA