Description :
From Genome Similarity Track
Location :
Scaffold_65:21854- 22988
Transcript NameFunction/comments
g1710.t1XP_009522048.1 hypothetical protein PHYSODRAFT_493381 [Phytophthora sojae

Sequence
1134 bases(100 bases per row)
CTCGCCTTCATAGACCTCGACCGTAAGACCGCGCTGATCGTCCTCAAAGGTCTGAAAGTTCTTGGTCACCGTCGTTGGGATCCGCGCGTTCCTGGGGAGG
ATCACTTCCATGCTTCCATCCGCCGTCTCAAGTCCAATGGGCAGCGGAAGGACATCCATCATGAGCACATCGCGGAAAACACGCTGGTCCATGCCGCTCA
AGATGGCAGCCTGGATAGCAGCTCCCTCACATACCACTTCGTCAGCGTTCACAGACATGCAGAGCTCCTAAATCACGAAATGGAAGTGAGTCAGTAAAGA
GTAGCGCCCACATACATGACACGACCCAACGGCAACGCACTTTGCCATTGAAAGCCTCCGAGATCTTGGTGCGCAAGATCGGGATCCGCGTGGATCCACC
CACAAGGATCACCTCGTCGATGTCGGCAGCTTCCATCTCCGCCTCCTTCAGCACGCTCGAAACGATCCGAAGACACCTACAGAGACCCACGAAATAGTAT
TGAGTAACAAACGATAGCACTCGGCGTTCACGTGGACATACTTCTTCCAGATCGGGTCGCAGAGCTGCTCAAACTTGCTTCGCAACAGAGAGTACGTGAA
CGTCTTCACGCCTGCAATCCCATGCACCGTAACATCAGCGTACTCCTCGGTGGACAGCTCGATCTTGGCCTTCTCCACTTCGCGTTTGAGCCTCACCATA
TCCACGTCTCCCACTTGTGCTCTCGTCACATCATGATGCTTATACAGCACCTCCAGCAAGTGGTCACATAGGGTATTATTGATATCCTCTCCGCCCAAGT
TGGTATCTCCGCCAATTCCCAGCACCTCAAACTTGCCGTCATCAATGCTTAACAACGACACGTCCAGCGTTCCTCCTCCAAAGTCAAACACCGTCACCAC
CTTCCTGCCTGACAAGAACAGTCCGTACGCCATGGCGGCTGCCGTCGGTTCGTTCAGCAGCCTCACAGCCTTGAACCCAGCCATGGACGCGCTCGTGATC
GTCGCCTTCCTCTGCGAGTCGCTAAAGTACGCTGGCACCGTGATCACCACGTTCTCTAGCCGCCTGCCGTCTTCAAAGTAGGCTTCGGCCGACGCTTTAA
GCTCTATCAGTACACAGGCCGAGACTTCCTCCGG