Description :
From Genome Similarity Track
Location :
contig_112:21846- 25568
Transcript NameFunction/comments
g11238.t1hypothetical protein PHYSODRAFT_319515

Sequence
3722 bases(100 bases per row)
GAGCAGCTCGCTCGCCGGCCAGCTGCGCGCTCGACGTCTTCTGCGCCACCATGCTAGCGTCCACCTGCCGACGCCGATGACATGACGAGCGACAGTTGGC
AAGCGTTCCGTCAGGTTGTTGTCGCCACGTTGGACAGGTGAGAGGAGCCATATCGACCACCACAGCCGTCAATCACGAGCTGTGTGCAACGCCTGGCCGT
GAGTCAACGGCGAAAGCGTTGATCCTTTCGCTCCTGATGTCGTGGCGTCCGTCAACAGCACTTCCCAGCCCGGCACTGCACGGACAGGTGGCGCGCGCAT
ACCAGCGTGGCGAGACGAGCTCAAGTATTTCGTTGTCGGACGACCGGACGAAGTGGAGTCGCTCCTTTATGCCGCCTTCACTGCTCTTCCTCATGTCACT
CCAGTCACGTCAGCGTGCACTTTCGAAAACCACGCGAGAGCAGCAAGACCGACAGTTAGTCACTCGCCACGCATTCACAACAGCTCCAGGACCATGCAGC
CGTGGTCTCCACCCGAGAACGCGATCGTGCTGACGGATCTACTCCGGCCGTCGCCTCCTCAACACCATCAGCAGTACCAGCCGCAGCACAGAGATATGAC
TACGTGAAGCAGGAGCCTCAGCTCGTACCTTCTCGACCAAGAATCGTGGAGCTCCCACCGCTCCTCCCTCCTCGAGCCCCGATGCTGCCAGCCTTCTCGG
ACGTGCTACGCACGACGAGTCCGCAGCACTTCCAGCATGAGAACCAGGAGACTGCGGCGTCCGTGCACCTCTACGGGGTTGTCATCGACAAAAGCAGCTA
CACGACCTCAACTGCCGTCGTCACAGAGCAATACCCAACGACGTTCTCTGCTACATTCATGAGTACGCCCGTCTGTTGTAGTGCTCCTCTAGCGCTTTCT
CGTCGTCTAACACCGTGTTATTTGCTCCGCAGCGCGACCACATGCTGCAGACTACCACAAGAGCAGTGGACTTGTGCTTCCAAGTCTCCCAGCGACGACA
AGCGCCTACGCCATTACCAGTGGGGACATGACGCCGCCAGGACTCGTAGGAGCACGAACTCGACCCATCGAAAACGTCCCACCCAGCCCGACGTCGCGGC
CAGCAAACCGCACGTGCAGATTCGCTGGCTGCACCCACTACGTAGTCGACCACGGTCTTTGCGTTCGCCACGGGGTACGTAGCTGATTCCTCCTCGCACG
GTCTAGCACCACACGCTGACGTCGTTCCTCACATGCCTCCTACAACAGGGTGGGAAGCGCTGCACTGCGGAGGGCTGCACGGCTCGTGCCAAGCACTTTG
GTCGCTGTTGGCGACATGGTACGATGGTCATTTTTGGTTTATGGTACCTGATAGGCCCTCTAACGCCTCCACTTTCGATGCAGGCGGGTCGGTCGAGTGC
AAGGCTCCAGAGTGCTGCAACCGCGCCAAGTCACGGGGCTTCTGCTGGTCCCACGGCGGTGGTACGAAATGTAAAACGGGAGCGTGCGAGAAGATTGCGA
TCTCCAATGGCCTGTGCTGGGCCCACGGCGGAGGTAAGCACACTTGTCGCCTCGTTGCGGGCACAGGACTGGTCACTTACGCCATGAATGAATGACTTGC
AGGCAAGCGCTGCATCGTGCCAGGCTGCCGGAAGCAGGCGTACGAACGGACCTGCAACTACTGCAACAGCCACTTCCAGCAGTACCAGCTGACCGCCCTC
GAGTTGGCTCGGCATAACCCAAGCGTCTGAACAATTCACATGGTTATTTATTCGGGACAACGTCTACGTGGACCTTCCACCTGGAACCAAGCCCCACGGA
AAAACGTCGCGCTGTTCATGATCGCTGAGATCCGACGGAAAGGAGGTCTACGTAGAGGAGGGTACATGTACTGTTGAAGGAAAGGCGTCGCGATGGCTTC
GTTGAGTATTCTACGTCGAGCAAAGCAAGAACAGTCAGATCCGTTGTTTTCACGAACTTCACGACTTGTTGATGGTGTAATTTTGCTACAGTTCTGACGA
GAACTCCTGCTTCAGCAAATCAGTGCCATCGTTGTGTCGTGCGTTGCCAGCCACAATTGAGAAGCTACCGGTAGGCGTCTTCAAGTCTTTGAGTCCCCAC
ACCGCGTGCCTCACATACAGTTGATACATCATGAGCAACGCGTTACCAGTCACTCTCGACGATCGTGCCCCGTGAAGCTCACTGTCTGTGCAGTCTGCGC
ATTGACACTGGATCACGTCTAAGCATGCATTTTTCACTCAACCAATCATATAGCTAGCGTGTCGGATAAATACTCTCATTGGTCAGCGCGCAAACATACG
CGCGCTTATTACTCGACACAAAATAGCTCGCGTCATCAGCATCAACGGCCGGCCGATCGGTATACGACCCCAAGCAGATTAACCATGACTTTCAAAGTCC
TCGCCACTCCTCAATTCGCCTCCAACGCAAACAATCGCCAGCTTCACAATGCCCAGCTACCGTGAGCTCCAGTGCACCAAACTGACCACCAACTTCCGCG
AGGCGACGGAGATCGTGACGTACCCGGATCTGCCCACCGCCAGCGCCGGCCACATCGTGGTCAAGAACAAGTTCCTGGGCGTGAACGCCACGGACATCAA
CGTGACCAACGGCGTCTTCAACGAGAACCCGCCGCCCTTCGGCACGGGGCTAGACGCCGCCGGCACGGTGGTCGAAGTCGGCAAGGGCGTCACCCAGGTC
ACGGTGGGGGACTCTGTCGTGTACGACAAGTTCGGCGCCTACGCCGAGTACGTGGAGGTGCCCATCGACTCTGTGCACAAACTGCCCGAGCTCTCACCGG
CTGCACTACCGCTCACGGTGTGCGGCATTTCGGCGTCCATCGCCATCAAGGAGTGCGGCGAACTGTCGACCAACGAGACGGTGTTCGTGACTGCGGCTGC
AGGCGGCGCTGGCCAATTCGTGGTGCAATTGGCCAAGATGGCGGGCAACCACGTTATTGGCACGTGCAGCAACGATGAGAAGGCGGCCCACCTGAAGACG
CTCGGCTGCGACCGCGTGATCAACTACAACAAGGAGGACATCGATAATGTGTTGAAAAAGGAGTACCCCAAGGGAATCAACATTGCCTTTGAGACCATCG
GCGGGCAAATGTTCAAGACCGTGTTCGACAACATGGCTGTTCGTGGCCGAATCATCGTGTTCGGACACATTTCGGAGTACCGTGGCGACATACCGCGCTC
GCCGTTCACTGTTAGCGCTATGAACGAGGTGCTGCTCATGAAGGCGATCACTGTGCGCGGGTTCCTGCTGCGCACGTACGCCGACATCATCCCGACACAC
ATGGCAAACCTCTTCAAGCTTATCAGGAAGGCAAACTGCTCGCTGGTGTGGATCCGACCGAGTTCCACGGACTTGAGCAGGTCCCCGACGCCATCGACCA
CATGTACGCGCACAAGAACATTGGCAAGATCGTCGTGCAGCTCCCCTAAGGGCGACGTACCAGCTGGACCTCTTTTTTAGTGAGAAAGGCAGTGGTAGCT
GAAGAGCTAATCAATGTTCGAAAGCCAAAGAGAAAACAGTTTACCAGTCTCAGCTTTTGTGAAGCTCTCTCATCACTCCGAGGAGACCATCAGTGTTGCC
TTGTTAGCCGACTTTGCTTGTCGAGAAGTAGAATGGATTGGCGTAAGAAAGAAACGTAGCAAATTCTTCTTTGTTCTCCATGACGGCGAAGGTTGTATGC
AGTCTTCAGTGTAGCAAAGTAA