Description :
From Genome Similarity Track
Location :
Scaffold_791:2184- 3233
Sequence
1049 bases(100 bases per row)
GGGAGCTTACGTCAAAAGTGCGTTCTGCTGTGCAGGGGGAGGAGGGGGAGCTCGGCCTGTCTTGACTGCGCGCGCTCTCTTTGCCTTCCGCTCCACGCGT
GTACACGAGTCCAAACTGTTGAGCAAGTGGCGCGGTCTGGGCTTCTTCGCCACGGCTGGTCTGCCGCGCGGAGAGAgtgcatacaaactccaagtgCGCG
CCGAAGCACAGAAACAAGACGAGAGGGCCTTTCTCTGGACGTTCGACCCCTCGTCATCGACCCGTCGTCTTAAACTTTTTGGCCAATGGCCGCTATAGGC
CGGGTCTTATTTTGGAAGTTTTTTCACTTGGCCTCGGTATGGAAACTGGACCAGGGTTGTGTCACCGGCATAAAGCGGCCATTGGCCAAAAAGACTGTGC
CCATTTTCGTAGGTTGAAGTGCCTATTATTGAAAACGTTTTTCGATAGGGCTAGGTAACCGAAACCCTAATCATCTGCCCTTTTCGATAACTAGGGCAGA
GGTTCGGACGTGACTGTGTGGCTCTCAGCGCCGAGCCCTTATGACGGCGATACGTTGGGCTGGCAATCCACCTTCGGCACCTTGGCACGCCTCGTTAGGT
CGGCAGTCCAGCCTTCCGCGCCTTGACAAAGCTGCTGACAAAAATAAAAGGATTGGGGATTCAGCAGACGTCATCTCTCCTCTGCAAGCATGCAGTTTGC
TGGATCACCAAGAACGCGGGCGAGGCGACGTGGTCGCGCTGATCGATCGTGAAAATGTTGATTTTTCACTTGAGTTTTCTATCGTTTGACGACCGCACGA
ATGTTCAGACTCGGCTTTTGCAGGTGTCTCAATGTGGACTACCGCAGAGAAGAGCCAAAAAGGCAACACCGAAGCTGCCACCTCTACCAGTtcggcagca
ccaccacacccGCACCTGGCCGGCTGGCTGGTTCCATTGACGCGAAATGTCGAGGCTCGTCGCGAGCCAAGCTGCACAAAGCTTGACAGCGCTTTGAGCT
ACAGTTCGTGCGCTTGTCACCAAAGTggcgctctgctgcaacgaTCCTT