Description :
From Genome Similarity Track
Location :
Scaffold_72:218382- 220021
Transcript NameFunction/comments
Hyaar_Emoy2808021hypothetical protein

Sequence
1639 bases(100 bases per row)
CGATGGACCTCACGGCGGAAGATGACGATCTCCTGAGCTACTTTCTGTCGGCTGACGTAGCCGCAGAGCAGCCGCTGAATGCGCTTCCAATACGCGTGAT
AGAAAGCAGCCAAGACGTCGATACAGACGAGCAATTCTCGCATGGACAGACGATTCTGTTAGCTCCCGAGCGCCCGTTTGGCAGCGACGGCACAAGCAGT
AGCGCCTCTTTCCAGCCAACGCAAAGTAGGAGTTTCATGGAGAGTTCGATGATGCGTCCGTTGATTAATGATGACGACACGTCGTCAAGCAATGGAGCGC
TGGACACGGACGAGAAGCGGCAGCGGCGATTGGCCAGAAATCGCGAGTCAGCGCGTCAAAGTCGTCGCCGCAAGAAGCAGTACCTGGAGCTGCTGGAGGA
AAAGGTGTTTACTGTGTGCATTGTCTGTTATCTGATTTTATGTGTTGATATTGAAAAGTGGAAAATAAGAGAGAGAAGGTGAGATATTAACGCTGTGGTT
AACGTTGCTATTGTTGTTGTGTATGGACGAAGGTTTCCCAATTAACTGAAAGTATTGACACGACGCGGGCAAGTCATTTAGAGCGTGCAGACGAGACGTT
GAACCAGGTGCGGTCGAATATGTTAAAAAGTCTAGCGGCAGATCGGAAAAGCGGCGGCTCAGATGAGGTGCGTTGCATTGGTTGTGCTATAATTTGTCGT
TAAGGGATGAAAGAAAGAATGCAGTGGCTGATGAATGATCTGCTTGGAACTGGAGATTTTTCAGGAAAAGGTCCGACAGGTTCTGATGCTGATACAAGAA
CGCTTTGGACCAAATAGTGTCGTAAGGAGCTGTGCGAACGTTTTTTTGGGGGGGGGGGTTACTACGCTTTAGCTGCTGACACTACGACGTTGCTTGCATA
GGAGCGACTTGCTGTGAAGGACTACAACTTCCGCCAGCTTGATAATCTACTGCTACCTCCATACTGCCGATTTCTCTTGTGGCTCAGTATCCAGGACGAT
TCATTTTTTGATAAGGATGATGGAGTGGGGGCGAAAACCGCTGGAGACGCACCTGAGAAAAAGAAAGGCCCTGTTATGGTGAAGAAAGATACCTTGTGGT
CGACTTTGACGAGCGATCTCGCTCTTACTTACGAACAGGACGAGAAACTGAGGTCGTTATACAAGTAAGCTTATCGTTTGGCAAATGCGACTCGCTTGCT
GTATCTGTGGGCTGATGCGTTCGCGTTTTTGCACGTGGTACAGGTCAGGCGACTCGAAGAGCAGTAAGTTGGAGCGCCGACGGGTGGCAATGGCTGTGGT
GCGTGCAGAACTACTGCCGGAGAATTCTCGTATACGTCAGCGTTAACGTGTACTGTTTGCTTTTGAACAGACTTATTTATGCAAGCTGAAGAACAGCCTC
GAGCAGCGCTCGGAGGCGGTCCAGAAACAAACAGAGATGCTACACTCTATTCTGACGCCAGAGCAGTCGCTCACATATTTGCGGTGGGTGGATGCCAACC
AGGACCGATTGCCGAGCTTTGTCGACAAAACTGTGTCGGTGCCGAACACGGGTGCCTCCGATGCTGTGCGTGCTATTTTGAAAAAAGATGACCGTGATCT
CACAGTGGAAGATGTAACTGCGCTGCTGGGAGAGCTATA