Description :
From Genome Similarity Track
Location :
Scaffold_697:21837- 22940
Transcript NameFunction/comments
Phypl_g10391hypothetical protein

Sequence
1103 bases(100 bases per row)
GGCCCCCAAACCGATGTGGTGATTACCCACGGCGACGAGGGGAGACGGTACGCCTGTGGTAATCATCACGGCGGCAATCACGATCGTAGTCATCACATCG
TGGTGACAGTCCACACCCAAGTGGTGGTCCGCCACGTTGAGGTCCGCAATGACTCGGTGGGCCACGCGGTTGTGGCGCAAATCGTCCACGAGGCGGCgac
ctcttcctcgctgcGGTGATCCTGCACGTCCAacttgtggtggtggtgagcggTCTCGTTCAAACACACGCGGCGGTGAACGGTCTTGACCTTATTCACG
CGGCGGTGGGTCAATTCGTCCCGGTCCGTGTCCACGAAGTTCCATCTCATATGGACTCAGTAGTGGCGGTCCGTAATCATTGCGTTGCACCGACTCTTGA
CGTTCACGTTGCTCAAAGCTAGTACCCCTGTAGTTATCCGCATGCGCAAGTGCACCTACTTATATTACGCGGCGGCTCAAACGTAGATCCTTGCGAGCTC
TGTATCAGTCCTTGGCCGAGGTAGTACAGCACCTTTTCCCACGAAGGAGGTGGTCCCAGCGACCTAGCACCCTCCCACTGGCTCTGCACAACAGGTGTTG
CAGCAGGTTGCAACactggtggtggctgctcCACTTGTTGGACAGGTGGAGCACTTGGTTGTAGCTGTAGTCGCTGCCGTTGCAAGTATGTTCAGCTGCT
CAGCTCGACCTTGCTCGCCTTCAGCTGGGCATGCCACTTCATATCCATCGCTTCTCGCAGGAGTCGTAGGTGAATAGGTTGGAGACGCCGTCGCACCAAA
CGTCTCACCACCCTCAGGCCCACGGTGTCTGCAATACTCGGCGGTGTACACAGCGACATCGCCGCAAAGAgaccttgctgctggtcaccaGCTGCGTCGG
TCTCCACACGGCGTACGGAGTTCACCAGCGAGACTggcgccttctgctgctgcttttgcttCCTCGCCTTGTCCTTCGCTGCAAGATCCGATCGCAGTGG
CAGCCCGGTGTGCGCAGTACACTCCGAGTACCAGTGTCCGTCGCCATGGCAGTTGGCACAGTTCGTGCGTTGCTTCTTTTCCGCAACACTCTTGCCGTGC
TTG