Description :
From Genome Similarity Track
Location :
Scaffold_61:21832- 22904
Transcript NameFunction/comments
Physo_138171hypothetical protein

Sequence
1072 bases(100 bases per row)
CCTCCAATCCGACACCTGAGCGGCGAAGGCAGTGACGTCTTCCACGTTGAGAACACTCGGATCAGCAGCTGGATTCCCCATGGAGAAGCTCGATCGCCGA
AGTTCTGCTGACTTCGCGGCATCCCCACCCGCTAGCTCACCCGCAAAAGAATCCTTGCCACCCGAGAAGTCCACCTCGCCCTTGGGTTTCACCGCATTAA
CCCGGTTTCGCACGGTGTTCGAGTTCTCAAATTTTGCGAGTAGCGCCTCCACTTCTTGCTCAGGGTTTGGGAGATTTCGGTTGATTTTCTTCGCTCGTTT
TCCTCCATCGTCCGACCCAGCCCCCAACCTGTCCTTTGAGAGCGTACTAGTCGCGAAATCGCTCCCCATCGGTGAACCTGGACTCTCCAAAGCCTCGAGT
AGCTCGTCCACTTCCTGTTGCGGTGTCTTCTTGCCCCGCTTGCCCTCCTTGAGTCTCTTCCCTGCTCCACCCAGAGAGCTCGCCACCAACTTTTCTCTTG
ACGAGCGTAACTTCTCAGCCTCTCGACTGTACCGACGCGCCATCATCTCGATCGCCGCATCCGACGACAGACCCGATCGGAGAAAAGCTGACGTCTGCAG
CGACTTGCGGTTGACCTTGTCGAACGAGGTGAAGAGCAGGGGTGGGAGACCCTGACGTGGGATCAGTCGTGCTTGCTGGCGAGCACGCAGCTCGGCTCGA
GTCTCGTTCAAGAAGTCCGTGCTCAGGTTGGCGTTGGCGGCAGCGTACAGTCGCTCCCACGCAAAGTAGAGCGGGATTTCGTCCTGAGACGTCAGGTCTC
GACGACGCAGGTACTCTCTCGCGTCTCGCATCGCTGCCTCGTAGGACGGCAACGTACTGCCCATCTTGACTTTTGCAAACCTGCAATGGCAGCAAGTGCG
AGAGGAGAGAACCAAATATGGCGTGTGGTGTTCAACTCGTGCTGTACGCGCTTCATTTAGCGCGGCAAAGCAGCCATCACCTCTCGTACTCTGTCGGCAA
CTTCCGCCATTCCAAATCAAGTGCTGATCCGTCGGAGTTCTCCATCCGTATCAACGCGACAACTATAGCTCC