Description :
From Genome Similarity Track
Location :
contig_35:218319- 224643
Transcript NameFunction/comments
g6771.t1hypothetical protein PHYSODRAFT_354995
g6772.t1hypothetical protein

Sequence
6324 bases(100 bases per row)
GCCTCGTACGACGACGACGCCGACTATTTGGACTACGACAAGGCCGGCCGCCCCTTCATGGAGCAGATGAGCGGTTCGTGCGGCACGGCCTACTTCTCGG
GCATCATCGGCGGCGGCGCGTACGGAGCCGTCAAGGGCTTTGCGCGCTCGCCCAGCACTAAGTTCAAAATCCGGATGAACTCGCTCATGAACGGCGCGGC
CACACGTGGGTCCAAGGCCGGCAACGCGCTCGGCTGCATCGGTGCGTGGATTTGCGGCCTTTATGAGTGTTTTCCGAGCAGTTTTACTGAAGTTATGTGT
TTTTTGTGCTGCAGCCATGATCTACAAGGCATTCGAGCAGGTGGCGGACTCGGCCGAGATCGAGAACATCGTCAAGTTCGACCAGGTGACGCCAATCCTT
GCGTCGGCGGCCACGGGCGTGTTCTACAAGTCGACGGCTGGCCCCAAGGCTATGGTGCTGGCTGGCGCGCTCGGCGCCGGACTTATGTCCGTGGTGCAGT
TCGGCATCAAGCCCTTCTACCCGCGACTATAGACGCGCTCTCGGTTTGTTGCTGAGGTTGTGATCGCAGCGAGCGAGTTTCGAGTCGAGAGATTCCACTC
GACTCTAACCAGTTAGATGACCAAGTCGAGCGAGCAGCGGAAGGACAACGTGGAGATGCATATGTAAGTTAGTACAGCGGATTTTCATCTTAACCCATTA
TTCCCCGAAGAGCGTCCTATTGGTACGTAGCCTACAGAGTCCGAGAGGGCTAATGCCTGAGCCGGCTATCACCCTGCAACCCTCTCCACCTCCAGATAGG
CACATGGTGACACTAGGAAACGTTTCTGCTTACGTCTTGTATAGAAGCAAACTTGGACGGTGCTCAGCCTCGTCATGCAGGTCGCGTGACGTGACATCCG
TTGAGTAGCTCTCGAGCCGACGCAGCATTCTCCTCGAGCCTTACATCCGCGCTGGGAGGTCCGCCAAGCATAGCATTTTTGGATGTGGCGGGTAGCTCCT
CAGCCGGGACTCCTTCAGCGTTCCTCTTCCTCCGCATCCTCCTCCTCGCCTCCGCAGAGGACGGCGCTTGCGCGGCGCTAGAGCTTGGAGACTGGACGAG
TGTGCTTGACGGAGCGAAGTGAAGAGTGAGAGCTTGCTGGAGCAGTGAAGCGCTGCCAGCGAAGCTGGGTTCAGTGTTGAAGTGCGTACAGGCAGCAATG
CGAGGGAGGCAAATTACGTGGATGGTGTACAATATGGCAGTGCAGAGCTTTAGGTTAGCCTTGAGAGAACTGTACGGACAGACCTTCCCAAGTCTGGACT
GGTTAGTGCTTTATACGTTCCTACACGTTGTGAAACAGAGGAAAGTTCATCACATGAGCGTTGAAGTCCTTCATGACGTAGCACAGGTCGGGTAAATGTA
GTCCACACCATAGACCTCTCATTCAGCTTCCCGCGCTTTTTCGCCTCCCAATTGGTTCAAATTCAAAACGCCATCGATCATGTCGGCGTCGTACGCGCTG
GAGCTGCACGCGCTGAAGGCGGAGCTCCAGAGCACACTGGCGCGTCTAGGTATCGACACAGTCAGCTCTGATGATGAAACAGACGCTCGGCATCACGTAG
ACGCCCTGTCGGTACTGGAAATCGCCGCAGAATCGACCGAAACGCGACCAAGGCGGCGGAATTCTGGCCGCAATCGGCCCATCACGCGCTGGAACCGCCG
TCGATTGGTGCACGAGTTGGCTGCGGCATCCAGTAGGAGGCGGCAGCTGGAGACACAATTGCATCGCGAGATGGAGAGCGACAGGCAGCAGCAACAGGTC
AGCGACGAACAGAGCAGACGCCAAAGCGCGTGGCAGGCGGCGATCCTCGAGTTGCAGCAGCAACGCGCCGAGATTCAGAGGCAAATGGAGGCAGAGACAG
CAGAGGAGATGCATCAGACAGCGGAGAGGGAGCGGGAAGAGCAGGTTTCTGGTGCTGAGGACCAGAGTGAGAGAGTGACTGACAGACGACCGACGGTGGA
GTCTGTATCAGAGACCCACTACTCGATTGGCGGTGTGGTGACGTTGGAGCCTTTGGCTTCATTTCAGCAGGTGCCAGGGCTGGCAAGCTCGAGAAGTGGG
GTTTCGATGCGACCGACCGTTGTTACTGCGGCAGCTGTGTCGCCAACGGAAGCTTCAGTATCAGCACCAGCGATGGTGTCGGTGTTGGATGCTTATCCTC
GCTACAGGAACACGCCGGACGCATTGAGTGACGTGTTTTCGCTGCAGCTGAAGTTTGCGGAGACGATGCTCAAGCTTGAGAAGTCGGTGCAGATGCGTGA
TCGGCTGCTGCATCATGGTGGAGCCTTGCCAAGCATCGTACAGCTGCATACAATACTCGACAAGAGAGCCATGCACGTCGTCGTCATGGTCACCAGTCTG
TACATCGCAGAGCATCATTTGAAGGCAATTCCAACAGCGACTCTAGCGTCATGTATAGAGAAACGCATCGTAGTGAATCGTACAGCTCCAGCGTGTATTC
GCCTTCGTCACTGGATTCAACGCCGCGACGTGGCGAGACCATTCGAGTGAGGTACCCGAACTTCGGAGTATCAAGAGCAACCACGGCTGAAACACTTGCA
CCTTCCTCGTCGTGCGCAATTCATTCGCCTAGCTTGGACACGACAGGTGGAGGTGCGCCTGCATCCTCCACGACAACTTTATCACCTCAAGAATCGCCAA
GCGCACAAGATGCTGCTGCGCAAGGGAGCGACGCGCAAGGCGAGCTTTCCGAAGCCCGGGACGAAGAGATTCACAGGACACCCACCACCGGTAGTAGTGT
GACTACCCCGACGACTGGGAGTGATCAGAAGTCCAATGCGTCATCGAAACAGGTTCGCTTTGGAGATGATGCGTATTCGACTCCAGTGCTTGCCCGTAAG
TTCAATTTCGACAACCCGTCGATCGATGAAGATGATTTCGAGGAGAAGACGGAAGACGAGGAGAGCATCCCGAGCTTCCTCGGTGGATCTACCGTTACCA
GTGTCGAGCTCAATGACGCTTCATTTCTTCGAGCTTTCCAGCGCTTCCGTCGCGAGTTGAAGGTATCAGAGCACGACTCTTGCCTGCAATCACCGGTGCT
AGCGAGGAAGCTTTTCCCAGCATCAAATATGGACTTTCCTTCCTTAAATTCTGATGATGAAGGCGCGAAAATTGATTTATCGATCTCTGATGGAGCGACA
GGCGACAACTTTGCTCAATCTGCCAGCGCTCCTGTTGAGGAGCACGATCAAACAGCAAGGTTTCCTGGTCTCAGCGGTTTGAGTGTAGAAGAGTTACAGG
AGCGTCGGAGGCAACTCTGCCTTGACATCCAGGCGGCAAGTGCCCAACTTGTGCTAAACTTTGGGGCGATGCAAAGCGTAGCTACTGGGTCTCAAGGTGC
AGACCTCACGAAGGACTGTTTGCTTGCATTACGAGATGAGCTCAAGGCCGTCGACTCACAGATTAGGGAATTGCAATAGACGGTACGCTTGTCAAAGTCT
CTCTCTCATTCCAGAATCTGCCGTAATGGTGGCCGTGACCGTTGTCTGTTGCATCGTTGGAGATGGGGACGTGGCCCCGTTGAGATCGAGTCAAGCAAGT
TGTGGGCTTGTTGAAGAAAGTGATGGCAAGAAAGCTGGACTACACGGGGCAGGACTACAAGCTGCAGTTCTTCCTGGCGAAGACGACGGGTGGCGCGTGG
TTGATGTCGGATGACCCTGATGTGATTAGTATGCGAAGTGGAGCCACTTGTAAGCGAGTGAAGAACCTGCTGAGTGAAGAAATCGACCCAGCAGAGAGAT
TGGCGTCTTGTTTGCGAATGCTCTGACGAAGAAGACGATTCACGTGCTGGTGGTGATTCCGGAGGGTGTTGGAGGTCCAACGTTATTGCAACAAGTGAAT
ACCGTCGTATGCGAGGGTGTCGTCTGGTATGTCGTGAAGGGATCGCATTGGTCTCTACGACCAACGAACGCTCTCTCGCGAATATCATCGACCGACTCAA
AGAGGTCTATGTTGTGCTTGTCAAAAGTCCGCCAATGTCTGGGAAAATATCGCTGGCGAAGTTAGTGAGCTCGCTTTGGCCATTAGACGCAGGGAGGAAC
AGAAGAAGGCGGTTGAGTTCAATTTTTCGGTTTTGGGGATGTCCGAGAATCAGACTTTCGAGGACATATTCGAGGAGTGTTGCAGGGTGCCGTGGAAATA
CGCAAAGGTGGAGCTCCCAGCGCCAGACTGCGTGGTGTACCTGGTACTGGACAAGACGTAAGTGATCTACCAAGATGACAATACCTCCTCCCATAGACAC
AAATCTAGTGGTGTTTGGGAGCTGGTCAAATTTGTTCTGTTTGATACCATACAATGTGAGAATCTTGATGTTTTCGCAGCTTATGGCTCTGGAGTTGAAT
ACTCTCGTTGAATACTCTCAACTCGCTAATCCAATTTTGCTTCGACGAACGAATGGTGTTCGGGGTCAAAGAACTGGATTTTAGTCGTGCCGGAAGTCTC
TGAGTGCGTCGCCAAGTGGTTCGAGGACTTGGTGAGGAAATGGTTACAGAAGTTTGTTATCGTCTTTTCGACGCTGTGACCCACGAAGCGATCCCTGGGA
CCCAGACAGCTTCTGTGAAACGAGTCGATGATGTCCAGGATATTGAAGATCTCTGCATCAAGATTCGTGAGCTTGCCCGACGACCATCAACGCCACGCAG
AGACATTCTAGCGAATGTTGCGCTCATGCAGATGAAGGTGCACCGGAACAGGGCGGCATATGATGCAAAGCGACGGTCGATACCATTCACAGCTCACCTG
AACGGGTTTAGAAAGGATGGGTTAGTGCGCTCATTGTCGAGGAACCGCTACCACCGAGGGAAAGAGACGTCTACTACGAACTAACAGCTGCCGACGGTGG
TCTCGATTTCACAGACACTAAGCATCTTCAGTCCGTCTAACGAACTTGAACAGCATCGACGACTTCAAGAAGAACGTTTTGGACTTGAGTCGCCCGCTAC
TCGCCGAATATGCGCCACATCATGTAACTGTTTATCCGGACCGGGAAACGAGTGGCGCCTTGGCGGTGGATGCCAGACTTGGGACGTATGGTGCATCAGC
CGCGAAGGCGCTGGTTGTGAAAGTGCCGTCGCGACCAAGTAGGCGGCTGAAATCAGTGTGGCATCAGACGGTGACACTTGACCCTGCTGCTTCCAGACTG
CCGCTCGGTGAGGAAAGCCCAGTGTGGAGAATTGATCCGACTGCTATGGTTTTTTGGTATTTATGAGCTTTGCAAGAAGTTGTGCTTGTACTGTCGCGTT
GACACTGTTAAGTTGGCCCGCTTCTTGCAGATCCATTGTTTTGCGGTAGCACCTCCAGTGTGTGTTCTCTTGGAAGGAAACGAGAAGATAACAATTTAAC
AGGAGGAAACAAACTTACTGAATGACATGGACCTACTTCTGAATGAAGTTGAAGATACAAAGCAGCACATCGTGTTTCTTGATGGGGTTACACAGGAACA
GGACCAGGCAGTGCGTGTTTGTATTGGCGCGAGGTAATTCTGCTATCGAAATACTACTTCGCTGGCGGGAATGTTCGCTATATGTTTCACTATCCAAAAG
CGCAAGTGATAAAACCCCTGGATGAGGCTGTCCAAGCCGCAGTGGGGACCCCATTGAGGGAGCGTATAAACACAGCTTCCTCATCGGTTACTTCAAGAAA
CTTTTAGACTCGCTCGCGGCAGCGATGTTTGAGGTCAAGACGCTGGAAATTTTCTTCGTTGTGGAAAGGCAAAAGCTGCTCCCTTTCAAGTTTTCCGTGG
TGACCGGTCAAGGAAACGTGATATATTATGGATGGCAGCAGGGCGAGGAAACAGGCAAAGTGAGGCGTGTAGCCGTTGAAGGGGTCGAGACCTGGAATGT
ATTGAATTGGTGAGCAAGGACCTTAATGACTGGTACGGAATGGCCTTAGCTTTTTGGCAAAGGACACAGAAATCGTTGAAATTGATTCACTATTGTCGGA
CTTTTAACCTTTAATCCTTCTACATGGAAAAGCTGAGCTCCAAGTTGCTTCACGGGGTCGAATTCTTCAATTACATCGATACGAGAGAGTATGTGAAGTG
CTTGAGCAACTTCTAGCGATTTTTGTGGAGCTGACCGCTTGAAATGCGTCTACTGGTCCTGCTCCTGGTATTGACACCTTGTACTAATGTCTGGCACGAA
TAGTTTGGGCTCCCAGGATTAGACTGGAAGATGTCGGTTGCAATTCAGAGCGGCACAGGAGGTGACGAGGTTGGCGATGCGCGCTTGCTCTGCCCCTGCT
GGCCTCCTTCACGCGTTCAACCAA