Description :
From Genome Similarity Track
Location :
Scaffold_261:21831- 23466
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_261-abinit-gene-0.42Myosin

Sequence
1635 bases(100 bases per row)
CATGTCGTCGCGCAGCTTGAAGGCCGCCGCGGCCAACAACAACGACGTGCTCACGATCGACCAGTTGCGCCACCAGGACGACTGGGTGCTAGACACGGAG
CGCTACAGATGCCACGTCTGCACGCGGAATTTCACGCGCTTCCGGCGAAAGCACCACTGCCGCAAGGTGCGCTTCTCTCTCTTTGTGCTGTTGGCTCTAT
GATCTGGCGTCCTTTGTGCTGCGATGGGTTTGTACTCACGGGTGCTATGATGTGTGTGTTGCTCTCCGTTATTATTTGATGTGATAAATATAGTGTGGCG
AGGTTGTGTGTGGTAACTGCACGCTGAAGAAGCAGGCGGAGCTGCCGGTGATCGGCAAGTCGCTCGTGCGCGTGTGCATGTCATGCATCCTGTCGCACGC
CAACTCGCAGGCGAACCCACAGGCGCCGCCTGCGCCAACGACCTCGACGTCGTCGTCGCCGCCCCCACCGGAGGAGCACTGGGACGCGCGCAACTTCCAC
TCGCCGACAGGGAACTCGGAGGGCGACCTCACGCACTTCACGTCGGACATCCACCAGCCGGACTTTGAGTACCCGTTGGACTTTGACTGGGACCATCCGT
GGCCAAAGCCGCCAATCGCCCCCGATGAGACCGAGCGTCTCGAAGTCGTGCGCAGTTTTGAGATCATGGACACCCCCACGGAGGATGTCTTTGACATTAT
TTGTGACCTGGCGTCGAACGCGCTCAAGAGTCCGATCGCGGCCGTGAGTCTGCTGGACGAAGATCGCGAGTGGTTCAAGGCGAGCGTCGGGCTCGCGCAG
AACGAAGTGCCTCGCTCGGTGTCATTCTGCGCGCACGCGATCATGTCGAAGGAGCCGATGGTGGTCATGGACACGCTGCTCGACAAGCGTTTCGCAAAGA
ACCCGCTCGTGACGGGCGCCGCGAAGATCCGTTTCTACGCCGGTGCGCCGATCTGCACGCCTTCGGGCCACCTTCTTGGTACGGTGTTCGTGTTTGACAC
TCAGCCGCGCACGTCGTGTGATATCGCAACCCTGGAAAAGCTCTCGAACGTCGCGATGAAGAACCTGGAGGACCGCAAGAATGCGCTGTCGGCTCCGATG
GAGAACGGCAAGCCGGAGCCGCCTCGCCCTCAGCAGGTGCGCTCGGCCGAGCCACTGCGCGGATCGGGCATCGGCATCGCGAACCAGGTAGTCGCTGCGA
ACGTCGTGCAGCACCAGTCGCAGGACCTGGTGGCTGCCAACAGTGTCGGCGACGGTCAGGTGACGGCGGGACCGAAGATGGAGACGATGCTCATGGATTT
ATTGTGCCGCACGACGGAGACCCAGCAGCAGCTAGCAACACAGCAAGGCGCGATGTTCCACACACTAGGTCAGCACACTGCAGATATCGACAAATTAGCC
ACTGCCATGGCGCGAATGGAAGCAAAATTAGACGCACTGGCTGAGTAAACCAGCACCGTCACTGCTACTACCCGCCACTTGGACGACGGCCCGTGCGAAG
AAGCGCGGGCACGGCGAAGGCGAGTGAGCGAGCGAGTGGATGAATGGATGGTTGCACAAGAGAGAAAAAGAGAGAAAGAAAGAGAGAGAGAGTGCGAATG
AGGTGAAGAACGCGGGCAACACGAGAGAGAGAAGC