Description :
From Genome Similarity Track
Location :
contig_49:218288- 222109
Transcript NameFunction/comments
g9719.t1hypothetical protein

Sequence
3821 bases(100 bases per row)
CCGCAGCCACCAGAATGGCTTGGAGGAGCTGCGACGCAATTTCCTTGACAAGAATCATGCTGTTCTCGTCTTGTGCGAGCGCATACACGATTGGGCGGAG
GTTGTACTCCACAAGGAACTGGATGGGCGATGTATGAGACTCGAAAAGACTCTTGAGCATCTTCAGCAAGTTCTTGCGCACAATCGCCTTCGGAATGAGA
CGCAGTCGCTTTAGGATCTCCGTCACAAACATGCCGCTTCGTCCGAGTGCCTGGTTAAGCCTCACCGAGCGACTCATAATCTCCAACAGCGGCTCCAGTA
GGTTCTCTAACTCGGTGTCCAAAGCGTTGTGGAAGTACACCGTAATTTTCATCAGATTTTCTGGAACGAGCAAGACATTCTCCATCTTCACCGTGTCGTG
CACAAGCCAAACGCTAATGGACTTAATGGCATCAATTTGCCAGTATTTATCCTCCAGCAACTCCAGAAAAAGGGACACGCTGTCGTACGTCCAAAGGTGA
GCTCGTGCTGTAGGCGAGGCATGCGCCAGATCACACAGGATCGGAAGCGCAAACTGCTTGAGCGGACTGGAATTCCGGACCACCTTAATAAGCGATGGAA
TCACACCAGCCTGTGCGGCATGAGTCTGGCGGTTGCGATTAATCCGACAGAGATAATACATCGATTGGAGCACAATGTTTTCGACCTCTTTCCGCTTCGC
GTCTGAGATAGAGGGGCCTTCTGTCTCTTGTTCGTTTAATAGACGCACAAGTGTCGGGATTGCTCCGGCTCGGTCGAGTTTCTCGAGTGTCAAGGGCTCC
ATGCTCAGATTACGAATACACTTGAGAACCTTCAGCATGGCGGAAACAAATTCGTCCGAATGCCGTATCAACGGCAGCGACCCCTTGTTTTGTTCCTCGC
CTGAGTTAAAAAGCGGCAAAGGATGGATAGCTTCCAGTAGGCCTTCCAAACAGCACCATCGCACATATGCTCTTTCACCACAGCATCTCCTTGAGAAAAT
AGCACGAAGACATCACAAGTCTTGTGAAGCTCCTTCATTGTCCACTGTGCCACTGATCCACGCCTGGATTTGGTCGGTTCTACGTTTGTTTTCAATAATT
TCGGCACACTTTCATCGCATTTCGGGGAACGCGTATCGCTCGCTGACACTGACGCAACAATCTCCGAAAAGACGACGACAAACTTTTTCAACAGACCCGC
CTTCACAAAAAGACGGCATATATCGTTCTTCGGGATGGTCTGGATGCTGAACACGCTGAAGATTCCATCCAGAGCGACCCGAAGCGTGTCCACGTCGTCA
TTAAGATTGGATGGTTTATCTTCCAGGGTCAAAAAGTCCACCAATACGGGTAATCCGCCACACGCGATGAACATTTGTAAAGTGAGCGAGCTTGTTTTGC
AGCACTGCCGTACAAACTTAGCGGCTTCCATCCGCACCGCGATTGAGAATTCGTTGTCCTCTGGGTTATCCATCCGGAATCCTCTGCCGCTTTCACCCGG
CAAGTAGTATGGGTTGTGCTGCTTCGTGAGCTTGATAATCACCGGCACTAGTCCAACCAGTGCCAAGTTCTCCTGGAACTTTTTGTTACCCTCGACAATC
TGCGGATGCAAGCAATAGCATTCAGAGTAAGTCGCACTATTCCAAACACAGCACAGCAAACAAACAGATCTTACGATATTGATAACCCTTAGTACGGCAT
GCAGCACGTCCATCTTCTTCATTTCCAGCGCCTCCATGATGTTGGGCACCACACCAGGCTGAGACATCAAGTCCCGCCTCAGAGTTACGTTCTGATCAAA
TATTTCTTCCTGTATAATGGCACGCATTTAGTGAGCACACGGTATCAAACCCCCTCTCCATCGACGATGGGCGTAGTGCAGGTTATTTCAACGTAACGTA
CCAAATTATTGCAAGCATCAAGGATGACCTGGTCTTCCATGCTTGGATCCAGTAACGAAAGTAGCTCTACCACTCGAGCTGTTGCCTTTTGGTTAGTGTC
ACGAGCAGTCGAATAATCGAAGTCCAACTCATCGTCAAAGAGATTCTCCTGCGCACTTCCCCCAGAAGATGACCCCACATTACTATCACGGTTGCCACCA
ACACGTAACACCAAACTCCCCGGTTGCTCTTCAAAGTCGAAGTCACCGTCGATATCAGCGTCCTCCTTGAAGTCACTGAGCCGTTTCTTGGCTGGAACTA
CTGTAGCACCGATAGGATCTGACTCCATAGCACGTTGTTGCTTTGCAGCTGCTTGCAAAAGTTGCTTCTCGTCAATATCATCAAATGTGAGGTCTTCTTC
CGGATCCTCGACAAACTGCTGTAGCTTTGCGATGCGGTTTTGAGCAGGAATAAGCGATGATCGATCCCACGAGTTCATCGATGACTTTTCGCCCTTACTC
TGATTCATGTTGACACCGCTACCACCGTGACTAGCATCCAGGATGGCTGAGTCCTCCGATAAAACTCTTGCTTCAGACCCCTCGTCATCCCACACATCGT
CGTCAAATAGTGCGTTCGCATCTTCTTTTGATAACTGGAACTTTGACTTGCTCGGCGCAGCTTCCACCGATGCTTTTGAAATGCTATCGTTCTTGTTCTC
GTCAGCTCTAAGCACGAACGGCGTGGGGTTAGAATCCACACCGAACTCATCGTCCCAATCCTCGGCATCCTCGTCGGACTGCTCATTTGCGACACTGAGA
GATCGGTAGCTTTTGCCTGAAGTTGGCGGTGGGATGTCCGTTGTAGACGAGCTTTTCTCGTATAGTTTAATAGTATTCAGCACAGCGTCACGATCGTTGG
AAGAGGTTACGCTCTCTGCAACGAGCTGCGTACTTTGCTCCACCTTGTTTTTCGGAATCTGTGCGATCCACGGATGTGCGAGGAGTTCCTCTGCAGATGC
TCGCAGTCGCGGCTCTTTCATGAAGCACTTCATGATGAAATCGTGCAAGGCCTGCAGCAACAAACAACAAGTCAGCAACACACAGTTTGCAATAATAAGT
CAAAGTGTCTCTACCGGTGACATGCGCTGAGGAAGCGGTGGGTGGTCTTCTTGTACGATTCGAAATAGTGCAGCCATGGGCGCTAGGTCGAAGTACGGTG
GCTTCATCGTAAGTAGCTCAATAATTGTGCAGCCCACGCTCCAGATATCCGAAGCAGACGACCAGCCAGCCATCTCAATCACCTCCGGCGCCACTACAAC
AGCACACTTTATTAGCACGGTGCTACACAAAGTTCCATTTAGCAGCAACGCACTCCAGTAGGGCGACCCCACAACTGAATTTGCCTTCTGCGTCTCGTTC
AGCTTGATCGCCACGCCGAAGTCGGCCAGCTTCACCAGTCCGTCCTTGGTCGTGAGGATGTTGGCCCCCTTCACATCTCGATGCAGCACACCTTGCTCGT
GCAGGTACGCAAGTCCCCTCAACACCTGCGTGATATACATGGCCACGAGCGTCTCCGATAGTGAGCCGAACTTTTTGATAAACTGGGCGAGCGAGCCGTT
CTCCATGTACTCGAGCACAATGTACAGGTTCCCCTGCGTCTTGATCGTGTCGTGGTACTTGACAATGTTCTCGTGCTTCAATTTGCGCAGCAGACTGATC
TCGGTCTGGTATGTTGAATAATACAGGATAGAGCCGTCACACACAACAGCACAGCGCTAACACACCACCTCAGCTTGTACCTCAATCGACAGCAGCTCGT
CCTTGTCGATATCCCGCAGCGACACTTGTTTAATGGCGACGGAGCGTCCATTACGTAGATCCAGCGCCCCATACACGATACCAAAGCCTCCGCGCCCGAT
CTCCGCCCCCAATTGCTATGC