Description :
From Genome Similarity Track
Location :
contig_49:218265- 222086
Transcript NameFunction/comments
g10185.t1hypothetical protein

Sequence
3821 bases(100 bases per row)
CCGCAGCCACCAGAATGGCTTGGAGGAGCTGCGACGCAATTTCCTTGACAAGAATCATGCTGTTCTCGTCTTGTGCGAGCGCATACACGATTGGGCGGAG
GTTGTACTCCACAAGGAACTGGATGGGCGATGTATGAGACTCGAAAAGACTCTTGAGCATCTTCAGCAAGTTCTTGCGCACAATCGCCTTCGGAATGAGA
CGCAGTCGCTTTAGGATCTCCGTCACAAACATGCCGCTTCGTCCGAGTGCCTGGTTAAGCCTCACCGAGCGACTCATAATCTCCAACAGCGGCTCCAGTA
GGTTCTCTAACTCGGTGTCCAAAGCGTTGTGGAAGTACACCGTAATTTTCATCAGATTTTCTGGAACGAGCAAGACATTCTCCATCTTCACCGTGTCGTG
CACAAGCCAAACGCTAATGGACTTAATGGCATCAATTTGCCAGTATTTATCCTCCAGCAACTCCAGAAAAAGGGACACGCTGTCGTACGTCCAAAGGTGA
GCTCGTGCTGTAGGCGAGGCATGCGCCAGATCACACAGGATCGGAAGCGCAAACTGCTTGAGCGGACTGGAATTCCGGACCACCTTAATAAGCGATGGAA
TCACACCAGCCTGTGCGGCATGAGTCTGGCGGTTGCGATTAATCCGACAGAGATAATACATCGATTGGAGCACAATGTTTTCGACCTCTTTCCGCTTCGC
GTCTGAGATAGAGGGGCCTTCTGTCTCTTGTTCGTTTAATAGACGCACAAGTGTCGGGATTGCTCCGGCTCGGTCGAGTTTCTCGAGTGTCAAGGGCTCC
ATGCTCAGATTACGAATACACTTGAGAACCTTCAGCATGGCGGAAACAAATTCGTCCGAATGCCGTATCAACGGCAGCGACCCCTTGTTTTGTTCCTCGC
CTGAGTTAAAAAGCGGCAAAGGATGGATAGCTTCCAGTAGGCCTTCCAAACAGCACCATCGCACATATGCTCTTTCACCACAGCATCTCCTTGAGAAAAT
AGCACGAAGACATCACAAGTCTTGTGAAGCTCCTTCATTGTCCACTGTGCCACTGATCCACGCTTGGATTTGGTCGGTTCTGCGTTTGTTTTCAATAATT
TCGGCACACTTTCATCGCATTTCGGGGAGCGCGTATCGCTCGCTGACACTGACGCAACAATCTCCGAAAAGACGACGACAAACTTTTTCAACAGACCCGC
CTTCACAAAAAGACGGCATATATCGTTCTTCGGGATGGTCTGGATGCTGAACACGCTGAAGATTCCATCCAGAGCGACCCGAAGCGTGTCCACGTCGTCA
TTAAGATTGGATGGTTTATCTTCCAGGGTCAAAAAGTCCACCAATACGGGTAATCCGCCACACGCGATGAACATTTGTAAAGTGAGCGAGCTTGTTTTGC
AGCACTGCCGTACAAACTTAGCGGCTTCCATCCGCACCGCGATTGAGAATTCGTTGTCCTCTGGGTTATCCATCCGGAATCCTCTGCCGCTTTCACCTGG
CAAGTAGTATGGGTTGTGCTGCTTCGTGAGCTTGATAATCACCGGCACTAGTCCAACCAGTGCCAAGTTCTCCTGGAACTTTTTGTTACCCTCGACAATC
TGCGGATGCAAGCAATAGCAATCAGAGTAAGTCGCACTATTCCAAACACAGCACAGCGAACAAACAGATCTTACGATATTGATAACCCTTAGTACGGCAT
GCAGCACGTCCATCTTCTTCATTTCCAGCGCCTCCATGATGTTGGGCACCACACCAGGCTGAGACATCAAGTCCCGCCTCAGAGTTACGTTCTGATCAAA
TATTTCTTCCTGTAGAATGGCACGCATTTAGTGAGCACACGGTATCAAACCCCCTCTCCATCGAAGATGGGCGTAGTGCAGGTTATTTCAACGTAACGTA
CCAAATTATTGCAAGCATCAAGGATGACCTGGTCTTCCATGCTTGGATCCAGTAACGAAAGTAGCTCTACCACTCGAGCTGTTGCCTTTTGGTTAGTGTC
ACGAGCAGTCGAATAATCGAAGTCCAACTCATCGTCAAAGAGATTCTCCTGCGCACTTCCCCCAGAAGATGACCCCACATTACTATCACGGTTGCCACCA
ACACGTAACACCAAACTCCCCGGTTGCTCTTCAAAGTCGAAGTCACCGTCGATATCAGCGTCCTCCTTGAAGTCACTGAGCCGTTTCTTGGCTGGAACTA
CTGTAGCACCGATAGGATCTGACTCCATAGCACGTTGTTGCTTCGCAGCTGCTTGCAAAAGTTGCTTCTCGTCAATATCATCAAATGTGAGGTCTTCTTC
CGGATCCTCGACAAACTGCTGTAGCTTTGCGATGCGGTTTTGAGCAGGAATAAGTGATGATCGATCCCACGAGTTCATCGATGACTTTTCGCCCTTACTC
TGATTCATGTTGACACCGCTACCACCGTGACTAGCATCCAGAATGGCTGAGTCCTCCGATAAAACTCTTGCTTCAGACCCCTCGTCATCCCACACATCGT
CGTCAAATAGTGCGTTCGCATCTTCTTTTGATAACTGGAACTTTGACTTGCTCGGCGCAGCTTCCACCGATGCTTTTGAAATGCTATCGTTCTTGTTCTC
GTCAGCTCTAAGCACGAACGGCGTGGGGTTAGAATCCACACCGAACTCATCGTCCCAATCCTCAGCATCCTCGTCGGACTGCTCATTTGCGACACTGAGA
GATCGGTAGCTTTTGCCTGAAGTTGGCGGTGGGATGTCCGTTGTAGACGAGCTTTTCTCGTATAGTTTAATAGTATTCAGCACAGCGTCACGATCGTTGG
AAGAGGTTACGCTCTCTGCAACGAGCTGCGTACTTTGCTCCACCTTGTTTTTCGGAATCTGTGCGATCCACGGATGTGCGAGGAGTTCCTCTGCAGACGC
TCGCAGTCGCGGCTCTTTCATGAAGCACTTCATGATGAAATCGTGTAAGGCCTGCAGCAACAAACAACAAGTCAGCAACACACAGTTTGCAATAATAAGT
CAAAGTGTCTCTACCGGTGACATGCGCTGAGGAAGCGGTGGGTGGTCTTCTTGTACGATTCGAAAGAGTGCAGCCATGGGCGCTAGGTCGAAGTACGGTG
GCTTCATCGTAAGTAGCTCAATAATTGTGCAGCCCACGCTCCAGATATCCGAAGCAGACGACCAGCCAGCCATCTCAATCACCTCCGGCGCCACTACAAC
AGCACACTTCATTAGCACGGTGCTACACAAAGTACCATTCAGCAGCAACGCACTCCAGTAGGGCGACCCCACAACTGAATTTGCCTTCTGCGTCTCGTTC
AGCTTGATCGCCACGCCGAAGTCGGCCAGCTTCACCAGTCCGTCCTTGGTCGTGAGGATGTTGGCCCCCTTCACATCTCGATGCAGCACACCTTGCTCGT
GCAGATACGCAAGTCCCCTCAACACCTGCGTGATATACATGGCCACGAGCGTCTCCGATAGTGAGCCGAACTTTTTGATAAACTGGGCGAGCGAGCCGTT
CTCCATGTACTCGAGCACAATGTACAGGTTCCCCTGCGTCTTGATCGTGTCGTGGTACTTGACAATGTTCTCGTGCTTCAATTTCCGCAGCAGACTGATC
TCGGTCTGGTATGTTGAATAATACAGGATAGAGTCGTCACACACAACAGCACAGCGCTAACACACCACCTCAGCTTGTACCTCAATCGACAGCAGCTCGT
CCTTGTCGATATCCCGCAGCGACACTTGTTTAATGGCGACGGAGCGTCCATTACGTAGATCCAGCGCCCCATACACGATACCAAAGCCTCCGCGCCCGAT
CTCCGCCCCCAATTGCTATGC