Description :
From Genome Similarity Track
Location :
contig_54:21826- 24092
Transcript NameFunction/comments
g10749.t1hypothetical protein

Sequence
2266 bases(100 bases per row)
CGTCGGCTCCCAGAGCCGACGCGCCATCTTTACCTCTACGCCTAACGGCGGAGTGTCTTTCGACAAATTGTGTGCCGACATTATCTGTCGACACGACCGC
GTCGCCCCGGACGCTTCGAGACCCCCTCTCGAATCCGATTGAATCAGGCCCTGCTGATTCGTTTCACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCG
TTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTGGTGGAGGGTCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCT
CTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCCAGTCGATCACCGGATCATGTCGTGCAAGCCGCGGCATGCCCAACACCATA
TCGAACTTATCGTCCAGTTTGAGGACGATAAGCTCGTCGACGAACTCCTTCTCTTGATACGAGAAGCGTACGCGGACGATACGCTCCTCGGTTCTAACAA
CGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACCTCCTCGAAGGCAAGCCTTGGAAGGCTCTGCAGTCGAGCAAAGTTGTTCGA
CGCACCACAGTCCACTAGTTTAGCTAGGTTCTGCGTAGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGGTGTTATCGGCG
TTCAGCCTTTGCCGATCGACAGAAGCTGCTGTTGCGTCCTGGACAAACCGAATTACAGCTTGTCGGCGCTGGACAAAGTCCATTGCATCCGAGCTGAACC
CCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCCCGGCCTGCGCGTGTTGTTCGTTGTCGTTTGAAGTGTCGTAGACACTGTTTTGTCGTCGCCATGA
CTGCGCGCAGTACGTGCGCGAGTCGTCACAGCTGATACATTGCTTGTATCAGCGTGCTTATACGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTA
AGGAAGGAGCTACCGCACCGAGTACGCTCGGTACGCGTGGGTGCCTCAAGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTT
GGTGGCGAACTCCGCCATCGGCAAGCAGTCGCTCCATTGATGGAGCGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTT
TGTCCGTCGGTCTGCGGGTGATCCGCAGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCC
GATCCGACACGAGAGTACTCGGATACTCTCGGAAGAGATAGGCCTTCACAGGCCCATCTCTAAGGCCTTTCATGAACGTGACGACCATTGTCGCCTCGTC
AATCGTGTTGGTCACGATGTTCGAGGCCAAGTACCGTGCCCCTTGGGCGTAAGTATGCACGTCATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCTCTT
GATCGGAACTCGTTCTGCGGGGGCTCAAACGCAAGTTTGAGCTTCTCCTTGAACTCTTCGTACGTGCTGAAGCACGTAGGGTCCGTGAGTCGGCGTCCAT
ACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGACGTATCGTCGACCCGTAATGGCAGTGTCGACCTC
GACAAGCCAACGGAGGAGAGGTTCCCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGACTCCACGCGCGGTGTGGCCGATGGCGACACCGAA
GTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTCGGTGATAGCGTTCGCAACATCGTTGCTACCGCCG
CTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGTCTGCACGCGCAACATGCGTTGCAGACGTGTTTGG
GCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAACGTGTTAGTCAGTCGTTGGACGGACTACAAAGTGC
TACCAGGTGTAGTGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTATGAGGAAGCGTAGGAGTAATTTACTTAAGTTTAGTATAC
TTGTATCCGCAAGTATACTGAAACCTAGATAAAGGAACCGAACGATAGCTTTGGTGCCAAATGAGA