Description :
From Genome Similarity Track
Location :
Scaffold_528:21826- 23458
Transcript NameFunction/comments
g14234.t1hypothetical protein

Sequence
1632 bases(100 bases per row)
CAGGTGTTTCCACCTCTTGTTGCTTCATCGGAGCGTCGACGTCAAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATG
TGCCACTCCACACGCATCGTTAGGGCTGGGCCTAGGATGCCTCGGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTCCGCCATCGCGGCGC
TCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAGGGCTATGCTCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAGCGGCCTGCAGCG
ATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGCCGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAA
CTCCGGCACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAGTGCTCGCGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAA
GCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACCTCCAATCAATACATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGTATGAGATCAT
ATCTCGAATCCAGGTCAAGGACCAGTCAGCGTTCAACGCTATCGAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACACGGGT
TCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCTACCAGCGCCTCGGCATACTGCCGACTACCTTCCATCGTGGAGCGTCAAGCATAATTG
CCCGACGCTCCCGAATCGATCAATATCGTTCACGGCTTATCAAAGCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGT
TAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCCTCGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGA
GCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAGCTGGGCTTCGGCTCGCCGGAGCCTGGCGCTGCTTACGCAGCGGGCAACCTGGTCGCA
GGTGCTGGGTGCTCCCACACACGAAGTACCGACGGATGCCGATGCGCTGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGGTCCAT
CGGCTCGGGTCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTCGTCTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGTGTTCAAC
GCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGAATACTTCCGTTCTGGCCACGCCAGTGCGAAGGCCTTCCATGAAGATGGTCACCGTGA
CCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGTTCGTAACTATTGGACGAAGTCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAA
GCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACTCGCGACAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTG
CCACACGTTAGGGCCCACTCCCGGGCCCGGCC