Description :
From Genome Similarity Track
Location :
Scaffold_833:2182- 8703
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_833-fgenesh-gene-0.0HECT ubiquitin ligase

Sequence
6521 bases(100 bases per row)
GCGCGACCTCAAGGCCATGCTCTTCGGGATCCTGGACAACTACGAGTACGCATCAAAGTGAGTGCGAGTACGAGAGCGTGCCGTGCTTTTCAAGGTAGGT
TGTGTCAGAAAATTTATATTTGAAGGATTTGGAATACCTCCAGCGAGTTATTCTTGGAATTCAAGAGTTGATCAAAGTAGGTTGCTTTTCAAGACTCGAT
TTATCTCTGAAGAGTTTACGGAGGGCGAGCGTGGCGGCTTGGTGGCTCGTGGTCGAATTGGGAACTGATCGACTGAAGGCAGCAAGAGAGATTAGTAGAG
AGGATGTGAGCTCTTCCAGTGTATCTGCTCACTAACACATTCTATGATCAAGCGTCTATGTTCAAGCGATTCTAGGTGGTGACCACCAAGAAAAGGTGCT
GGTAATCAATGGGAAGTACCAGTGCTGTACATGTACCGTACTGTGATCCAGCCGAGTCTGTACCGTAGGCACATTCCAGGTGGTGTTGTGTATCGTCGTT
GAAACCAGTAGCAACAGGCAGTGGATGTAACCATAGAGCTGTTGTTCTCGTGAGCTTCTCAGTGCCAACACGAGGCAGAGCTGTGCCAACACGAGGAAGA
GCTGGCGCATACCCATCCAGCCCCAGCAAAATCATCAGAAATAGGGCTTGAAGCCTATACAGTCACACCTCTATAAAATAACCTCTATATTGGGATTTTT
TCGTATAAGGGCTCAAATTTAGGGGTTCAAAAAATAATATAGGTTTTTGTATGGTGGTTTCCTATAAGAGAATAAGGAATAAGGGCATCTAAACCGAGGG
GAAGTTCAGTCTAAATCTATGCAAAACACATCTTATAAGGGCCAACTCGGCCAAATGTGAAAAATAAATAGTCTTAGCCAATAAAAAGTCAAATTTTAGG
TTGATGTTATCACTTTTTCAATTTTTACTTTTGAAAAATATGAATTTTTGCCTTTATAAAGGTATTGTATAAGGGCAACGTTCGAAAAAGTGGCCCAAAT
GTACCCTTATAAGGGGGTATGACTGTAAAGCTTTCACAGACCAAATATCCTACGGTACAGTTTATGTTCCTTGAAATTTTACCTTGCATAATAGCTATCA
TTTTTTGAGCAGCTCCAACAAACCAAAAGTAAAACCTCCGATCGGATCAATATCATCCATCATCCAATAGTAAAAGAGTCCACAAGCATTCTCGATAAAG
GATATATCAAAACCTGTTTATAATAACAAAAAGGTATGACATGGAGTGAACTCAAAAGCTCACTTACGTTCACTATGCGCAACACACACATGATGAGCAT
GGAGATGCTTTTCGGAACCATGTTGTCGTGGACTCGCTTTCTCTACGCTTCTGAGCATATTCACCGACTTGAGGCCTCGACGCAGCAGCAGCAGACGCAT
TAACAGGAAGGAGGCGCGCTTGTGCGTGTGTTGGTGTGTACAGCAACGAGCGCAAGATGCCGGACGTGGCGTACATCGTGGGCGCGATGGTGCTCATCGT
GCTCTTCTGGCTTAGCGCCGCCGGGCTGATCCTGAAGGCGCGCAAGTGGAGCAACCGCATGGCGCACGAGTTGGAGCTGCACGCGCCGCTGCTGTACGCC
CTTTGACTATTCGTGTATCACTATTATGCGCTTGCTGAGGAAGGCACTGTGGACTGATGAATGAGTTCTACATGTGTATGTTGGCACCGCTGTGACAGGT
CGACGGAGCACCGCCTTGACGCCGCGTTGAGGTAATGACTGACATGTTTACATATTACCGCCATTGGGCGTCCATGAGACTAATACAACTGGTGATTATG
TCAATAGAGAGGTCGAAGAGGGCTTCAACCGGTGCGACGTGTGCGACTTTGCCAACTTCAAGCGCTTCCGCTTCTGCAACGTGTGCGGCGAGGAGATCCA
CGACGAGGAGCGCGAGAAGCCGGCGAGCGGCGATAAGAGCACGCGCACGGCCTTCAAGCGGCTCTGGAAGTCCACGAAGCGCGGCTCCGTCGAGATCCTG
AGTCGCACGAGCCAGCCGCCGCAGCTCACGCGCTCCCAGCGCTCGCGACGGCAGCGTCGAGCCAGGTATAATTGCCTCTATGTGCATGTTGTATGGTCCA
GTCTGTAAGAGACAGATAATTGATTCTCATTGTTGTTGATCACAGGAATCGCAAGGAGTGGACGCGAAAGCTGATTGCAGAGGACAAGGTCGTGTGGGCT
CGTGAGGTGAGCGGCAAGACGGAGCTGCGGTTCCCAGGCTACGTGGTGCAGTTCTACGACGAGAAAGCAACAGAAGACGTCCAAGAATATGACTCCCACG
AGCAGCAGGCTCAGCATCACAATGACAACACCGTCAGCAGCGGTGGTGACGACATCGACGCTATTGAGGTCGTCGTGGAGCTGGCCACGGAGTCAGAGAA
TACCAGTCAGGATGATCAAGTTATTCCAGTGGAAGAAGCTGAGGTGCCAGCAGAAGCGCAGGCGGAAGAAAAAGACCACCACCGTACGCCACTGCTGACA
AAGGCCGAGCGGGTACGCGACCTCGAGTCCGCAGTCACAGTCATGAGCATGGAACTGATCGAGTCCACTTTTGCAAACCCCGCGAACCTGTCGATCGTCG
CGGCCTCGGACACAAACCTCCAGTGGCGTTACGTGACGGACCTCGCGGCCCAGGTCTTCCCGCCAAAGTACGCGCACTTTGTGATGTCGTCCGCGGGCGT
CGTGATCCCGGCCGAGCGCCAGATCATCAAGTTGAACGTGAACCGCGCCAACCTGTTTGAAGACTCGATGGAGTCCATCAGCGCGATCCCCGAGAGCAGC
GTCCGCACGATCATGCGGATCAACTTTGTGGACGAGCCTGGTCTCGACGCTGGCGGCTTGCAGCGGGAGTGGTTTGTGCTGCTGAACGAGCAGCTCGTGA
ACCCATCCTGCGGTGTGTTCCTCTGTGTGAATAAGGAGGACCAGATCTTCTACCTGAACCCGAACTCGGGCCACGACATTGGTGCGCACCACCTGATGTA
TTACTTTGCAGCTGGTCGACTCGTGGGACGCGCACTGCTCGAGGGTCAAGTGCTGGGCTTCCACTTGGCACTGCCAATGATCAAGATGATTCTCGGGATC
CCCGTGACGTTCAGCGATCTCGAGTACTTTGACCCGGAGATTTACAAGAGTNNNNNNNNNNTTGATCGAGAACGAGGGTGTTGAGAGTCTCGGACTGGAC
TTCAGCATCACGGAGAAGCGAGGTGACGAAATTGTCGTGGTGGACTTGATCCCGAACGGTCGGAGCATCGACGTGACGGACGACAACAAGGACGAGTACT
TGGAGCGCAGATTCCGGTATCTGCTCTTTGAGAGTGTAACCAGTCAGCTCTACGTCTTCTTGAAGGGGCTTTACGAGGTAATTCCACAGGAGCTTCTCAT
GCTCTTCGACCCAGAAGAGTTCGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCACCAAGTACACGTCCAAC
CTGTACGAGCACCCGGCGCTAATCTGGTTCTGGGAACTCGTGCGCGAGATGCCGAACGAGTACCGCCAGCGCCTTCTCCATTTCGCGACGGGGTCTTCTC
GCGTTCCGATCGCGGGCTTTAGTGGACTGACGAGTTACGACGGCCGCCTGTGTCCGTTCACACTCAAGGGCGTGGACCTCGTGAACGACGGCTACATCTG
GAGCCATGCGTGCTTCAACCGATTGGACCTGCCGCTGCACTACGACCGCGCGCAGCTCAAGGCCGTGCTCTACGCTGCGGTGGAGACGGACACGTATGGC
TTCACGACGAATTAGTCACTCCTGAGTCGCAGCGAGGACCTTCCGGGTATTTATTGTGTCGTCCCAGGCGCTTGGACAGCGCGTGTGTTTCAAGTAGTAA
CCAGAATCGGAACCTGATCGTGATGTCAACTTTGTTGTGCTGATTTGTCGGCGATCCCCCAAAGTGCGACTTCGAAGTATTTTACTATTTTGGATACACT
TGCGGAGATTTGATTGGTAGAAATTGCGATTGCATCTACAATACGCATCGCTCATTGGCTGAGATGATTTTTTCTTACTTTCCACACACCAAAATCATTT
AAAAATAATTGCATATCAATTACTTACAGCGGCTAGTATCCAATATGGGCGGCGACGCAGCACCACGCCACAATGCAGCGCTGCCACAACTCAATCCGCA
GCCATCGTAGAGCTACAGTAGACAGCCATGCAGGCGGCTGTAGTGGCGCTCATCGTGACCGGCGCGTGCACGATCTTCTTCGGGTTCGTGTGGCTCTGCA
TGAGATTCAAGCTCACAAGCACTGGCGACGGCGACGCGAACGACCTCAACGCGCCGCTCGTGGACGGGTACGCGCTCTTATATGTGCAGCCATCTCTCTA
TATGAACAGTGTGCTAATATGCATGATGTGGGTTCTGTGTGTTGCGACTCTAATAGCCACCGTTTAGACGCCGCCATCAGGTTTGTTTTATGGTGGCATT
TATCAATAATGAGAGCCTAATATGCTAACATTGTTTCGCTTATGCATTGGACAACACATGAACAGAGAAGCCGAGCAGACGCACGCCACGTGCAAGGTTT
GTGGCTTTGCGAATTTCCAGATGTCGCCCATGTGCAGCGTCTGTGGCGAGCCACTGCCCGTTGTCTCAGCAGCTGGCGGAGATAGTTCCAAGAAGAAGAA
GAAACCCAACAACAAGAAGAAATCCACAGGCAATGACGTGGTGGAGATCGTCACACGCGTGGATCTGCCTCGCTCGAGGCGCCAGGAGCGTGCTCGAAAG
CGCAAGGAGTGGGTGCGGACGATTGCTCAAGACGACAAGGTTGAGTGGCTCCGTGACACTAACAGTGGCGCCGACATGCGCTTCCCAGGCTACACTATGA
GCTTCCATGAAGGCGTCCAAGTATCACCCTCTGTCCCAGAGACCACAGTGCCAGAGGTGAAGATCGTCGTGCACCCGACAGACACTAGTGTTGCTGGCGA
GCCAGGGATTATCTCGACCGTGAGCGCTGATGAACAAATCTCCCACGAAGAAGAGCCTGAAGCTGAAGTTGGTCCTTTGAAGGGGAGTTTTGCCACAGCA
ACTCTCATGTCCATGCAAGAGCGCGCCCGTAAACTCAATTTGCTCGCCAAGGCCACGAGACTCGAGCTCACGGACGCCAGTGTCGCAGATGCGAGTCTGC
TGCCGATCGTCAAGGCTTCAAACGCGAATCTGCAGTGGCACAACATTCTTGAAATCTCTGCGCGAGCGTTCCCGTCCAAGCACGCACACTTTGTGACCAC
GACCACGTCGATGATCGTGCCCGCGGAGCGCGAGATGATCAAGCTCAACGTGCGCCGCGACCACCTCTTTGAGGACTCGATCGAGTCGCTCAACGTGATA
CCCGAGAGCAGCATCCACTCGGTCATGCGCATTACGTTCGTGGATGAAGCTGGGATTGACGCGGGCGGCCTCCAGCGCGAGTGGTTTGTACTGCTGAACG
AGAGACTCGTGGACGCCGCGACCGGCGTCTTCCGCTGCACAAACAAGGAAGAGCAGGCGTACTTCCTTAACCCGAACTCGCTGCACGACATTGGTGAGCA
CCACTTGACGTATTACTTTGCGGCGGGTCGCCTGATCGGCCGCGCATTGCTCGAAGGCTCGGTAATCGGCTTCCACCTGTCGCTCCCACTGCTCAAGATG
ACCCTGGGCTTGCCAATCACGTTCAGCGACTTGGAGCACTTCGACCCAGAACTCTACAAGAACCTGCTCTGGATCACAGAGAATGAGGGCGTCGAGAGTC
TCGGACTGGACTTCAGCGTGACTGAACAGCGTGGCGATGATGTTGTCGTGGTCGACTTAATCCCAAATGGCCGCAACATCGACCTGACCGATGACAACAA
GGACGAGTACTTGGAGCGCAGGTTCCGGTATCTGCTCTTCGAGAGCGTGTCGAACCAGCTTGGCGCGTTCCTGAAGGGCATCTACGAGGTGATCCCACAG
GAGTTGCTCATGATCTTCGACCCCGAGGAGTTTGACTACCTGCTCTGCGGCTCGGACGAGATCGACGTGGACGATTGGCAGAAGCACACCACGCTCTCGA
GCAACCTGAGAGAGCACCCGGCGCTGATCTGGTTCTGGGAACTGGTTCGCGAGATGCCGAACGAGTACCGTCAGCGACTGCTACACTTTGCGACTGGCTC
GTCTCGTGTCCCGATCGCAGGGTTCCGCACACTCACGAGCTACGACGGGAAATTGTGTCCGTTTACACTCAAGGGTGTCGACCTCGTGAACGAGGGCTAC
ATCTGGAGCCACGCGTGCTTTAATCGGCTGGACCTGCCGCTGCACGTGGTGCGCAGAGACCTCAAGGCGGTGCTCTACGCGACGCTGGACACGGAGATGT
ACGGCTTCACCACCGACTGAT