Description :
From Genome Similarity Track
Location :
Scaffold_37:2182- 3643
Transcript NameFunction/comments
Phypl_g1447hypothetical protein

Sequence
1461 bases(100 bases per row)
TTGGGGTGAAGCCGCATGGAGGCCGCCTGAACCTCAACGCTGCTGTACTTGACGTTGACTGGATTGCCGCGTgggtgaaggagctggcttCTCAACTGGG
AGAAATGGTTCCAGTTCGCGTGCGGCGGCAAAGACGCAAGGACGAAAATGTGTCCAAGGTGTTGACAACAGACACGTTCACAATGCTGCCCGCATTTTTG
ACTTgggagaagctgcacgagcagctgaCGCTTGCTATGGCAGAGGCTGAGCTCGATGCCAAAGTGCCTTCCTTGTCCAGCTTTAGTTCTATCGTCGCCA
AGCATTGCCGAACGATTCGTGTCCAGTCTCCACGCAGTAACGTGTGCGACACTTGCACGATCTACAAGTTCAGTCTGTGTGGTGTTAAAAGTGCTGCGTC
GACGGAGCTGTTTGGTAAGCACACTGAAGCAGCGCGTATTACTGTACGAGGTACGGCGGTAAGTATCAAATTGATTTGTGATGGTGATAAGTATCACTTG
GTTCTAACTATTGATCGTTGTTATTCCTAGGTTGGAGTACAAGTAGGATGTTGCGGAGTGTTCGGATGCAGCCATCGTCATTACGATGGACTTCCCTCAG
AacctgacgctgccgtcTGTGGCGGCAACACCTTCAGACTGGTACTTCATGTCACTTATCTGGGTACACGTCTTCGATGTTGCTATTGCCCACACCAACA
CTCAGTACAATTTTGTGTACAACGAGAGGGAAGCTGGAAAAGGAACCAATGAGATCAATTCAATGTTTGCGTACATGCTGGATGCGGTACTCCTTCCGCT
GAAGCCAAATAAACTCACTGTTTACGCGGACAACTGTGAAGGTCAGAATAAGAACAACTTCGTGTTGGGCTTCCTACTGCTGGTTGTTCAGCTCGGGTGA
ATCGACGAGGTAAACTGCAAGTTCTTCGTCAAGGGGCATACCAAGAATACATGTGACCGTGGATTCGGGCAGATGAAACGGCATGTGCAGCGCCAAGATT
GCTGGACAATCGACCAGCTGACGAAGGCCGTTGAGAAGTCGTCTAGTGCGAACCAGTGTATACGTGTGTCGGACGATAGGGCTTTTCGCAACTACAAGTT
TGTCGTGGATGAAATTTACAAGAAGGTCAAGTCGATCCAAAAGTACCAGCTCTTTAGAATGCGGCGTGAGACGCCCGGTGTGGTTGAATGCCGAGTTCTT
CCCGAAGCTAAGCCTGTTCTGCACGATCTGAGACGCGTCTACGACAGAGTTCAGGTTGACGAAGATCACGCAAAACGATTGCTTGCTGTGTACCTGGAAA
CCCTTCCACGACCGACGATCAACGCCGAAAAAGCAACGCAGATATACAAGTCAATCCGGCAGTACGTTCCAGCAGAGTTTCAGAGTGATAGTCTGTATGC
GGCACCAAGTCCAGAGCCAGAAGACGAGGCAAAAGCAATCAAGAAAGCGCGCCGTGAACGC