Description :
From Genome Similarity Track
Location :
Scaffold_1575:2182- 3343
Transcript NameFunction/comments
Pytir_DAOMBR486fgenesh_masked-pir_contig_1575-abinit-gene-0.18Nucleolar protein NOP5

Sequence
1161 bases(100 bases per row)
TTCTTCTCCTTCTTCGCCTTCTTCTTCTTTGGCTTCTCCTCCTCGTCGTCCGAGGCCTCCACGGTCGCTGGCTTCACCTCCTCCTCCTTTCGCTTCTTGC
TACTGGTCACCGTCATGTCCGCCTCGGCGTTGTATGTCTTGCTGGACTCTGGCTTCACGTACTTCTTCGCCTCGTTCTTGGTCTTGCCCTTGCCCGAGAT
CACGCCCGTCAGGCCGTTCTCCAGCTGGCGCACGCGCGCCTCCACCTTCGCACGGTTGTCAAAGCCGATCGTGGCTTCCGTGGCGTCACCGAGCGCGTCC
ACGCGCACAGCGAGTGCGGTCTTGGCCGCGAGCACGCGCGAGATCTTGCCCTTGTGCTTTGGGGCAGTCTGGCCGATGAGCGACGCGTGGTAGATCAGAC
CGTACTTTGGAGTGTCGTGCTTGGTCTTCAGCGCACGGAAGAGCGCCTTCTCCGCACCGAGGATCTGCACGGTGGACGCCGGGTGCTTGGCCAGGTTCAT
GAGCGAACCGGCGTGCGCAATGAGACGCGCGCCGACCAGCTCACCGACCATGACCGTGAGGTTCGGCGCGATCGCGTTCATGCGGTTCTTCAGGTAGTCG
AACAGCTGCGCGCGGTATTCGGTGAGCGAGATCACCTGTTCACAGAGCGACGAGATGTTCGTCACGTCCTCCTCCGAGATGTCGGTACCCATGGACACCT
CGCACACCTCGCGCATCGACGCCTCCACGTCCTCTGACAGGATGTCCGAGAAGTCCAAGTTCTTCACGTTCGATCGGATGCCCATCTTGAGCACCGACTT
GGCGTACTGCAGGTTGTCCGTGACGATCTTGCCCATTTCCGGGAAGTGCCAGCCGAACCACTCGCGCACGCGCATCGCGTACGTGTTGATCTCCTTGTCG
AGCTCGTCGAGAAGGCCGATCGCCTGCACGATCATCGTGTCCACCTTGTCAGCGCTGAACTTGAGCTTGTAGCGCGAGAGTGAGTGCGACAGACCGAGCG
TCATGGACTTGAGGTCCTCGTCCTCGAGACCCGAGATGAGCGAGTTCATGTTCGCGCGAATGCCACGCATCACTTCGTTCACCGCCGAGTCGTGCACGCA
CTGGATGCCCATCTTCTCCTTGATCAGACCGCCGAGCGCCTTGTCCGATACCGCGAGCTTG