Description :
From Genome Similarity Track
Location :
Scaffold_163:21815- 32036
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.18Copper-transporting ATPase
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.22Adenylate kinase domain-containing protein 1
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.23Protein kinase

Sequence
10221 bases(100 bases per row)
CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAGCGCCGACCGGGGATCATGGGCGTCAATATCAGTCTG
TTGACGAGTCGGGGCGTGTTTGAGTACGATCCAAAGATGGTGTCTGAGAAGGCGATCGAAGACATGGTCGTGAGCCTCGGGTTCACTGCTGGTGTGATGC
CGAACGAGTCCTTCGTGTCCATTGTGCTGCACGTCGGATACGAGCACCCAGCCAAAGTGTGCACCATGCTACTCGAGATGCAAGGCGTTATGTCTGCGAA
GGAGACCGAGGATGCCACGCTCACGACGTCGCCAAAGCTGGGAATGGGAGCGCAAACGGCGGTNNNNNNNNNNNNNNTACGACCCAGAAGAAACAGGTGC
GCGCAAGATCGTGCGCCAGCTTTCCGGTGCCGTGGGGTTCCAAGTGTACGCTTCGACGCCTCGGCCGCTTGCTGTGCAAAACGAGGAAGCAGAGGTGAAG
AAATTCAAATTGTTCCTTATGGCGAGCTTCATCCTGTCGCTGCCGATCCTGATCATGGAGTATGTGTTGCCGCTGTTTGTGGCGGCCGAGTNNNNNNNNN
NNNNNNNNNNNGCGTGATATCGTGAGCGGTCTAAGTTACAAAGACGCCATTGGCATGGTGTGCGCGACGCCGATTCTGTTCATCATCGCCTTCCCAATCC
ACGAGAGCGCATTCTTGGCGTTGCGCTACAGCTCCCGCGTGACGATGGACGTGCTCATCTCACTCAGTTCGTTCGCGGCATACATGTTCTCCGTCGTGAC
TGTTTTCATGGGCATTTTCCACGTCCATCCTGAAAGGTCAGAGACTTTCTTCGAGGTGACGGCGCTGCTCATTACGCTTATCCTTGTAGGTCGGTACATT
GAGAAGATCGTTAAAGCAAAGGCATCAAACAGTGTCGATGCGCTTCTTCGAATCCAAGCGAAAACGGCGATTCTCCTGGAAGCGAATGGCGGAAACGACA
AGTCGATGAAGGAATCGTACATTGATATTCTCCTCGTCGAGCGCGAAGACCTCTTGAAGGTGCTCCCAGGCACGCGCATTCCAACGGACGGTGTGGTCAT
TGAAGGCGCGAGTACGGTGGACGAGTCCATGGTGACGGGCGAATCGCGCAAAGTCGCGAAGGAACCGGGGTCGAATGTGATCGGTGGCACGATGAACTCG
CAGGGCGTCTTGATCATGCGCGTCACCCACACCATCACGGAGTCGATGCTGGCGCGCATTGTGAACCTTGTTGATGATGCACAGTCGTCCAAGTGTCGCA
GCCAAAGCGTGGCTGATGTGGNNNNNNNNNNNNNNNNNNNTCACAACATTCATTATCTCGATCTCGGTCATCATGTTCTTTGTGTGGTACCACTTGGCGC
GCAGTGGTCATGTCTCGACTCACGGATGGGAGCCGTTCCCGTTTGCGCTGCGGTTTGCGATCACGATCTTGGTGATCAGTTGTCCGTGCGCCATCAGTCT
CGCGGTGCCCACGGCGATTATGGTGTCGAGCACGATTGGCTCCCAGTTTGGTGTTCTCTTCAAGGGCGGCCAGGCGATCGAGGCTCNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACGAGCGGGAATCTCGCGGTCGTCGACGTGATCATTCCGACCACCAACGTGCCAGAAG
AAAGCGCACGAAAACTGTGGAGTTACATTGCAGCGACGGAAAAGAACAGCGAACATGCGATCGGGAAAGCGCTTGTATCGTACGCGCACCAACTCAATGC
GCCGACTTTGTCGGTCGTCAAGTTTGATTCGATTCCTGGATGCGGCGTGCGTGGATTCCTGGATGATGGCCGTCAAGTCAGTATCGGATCGCTCAAGTGG
ATGCAGGACGCGCTCAAGATCGGAGTGCCAGTGGATCTGCACATGGCGAACAGCAGATTCCAGCAACACGGCTACGTCGTCGTCTCGGTCGCGATCGATA
ACCAGTTGGCCGCTGTGATCGCGCTTCGCGACACACCACGACCGGAGGCACGACTCGTGATTGAGCAGCTGCGACGCAAAAAGATCCAAACGTGGATTGT
CACGGGAGATCAGCGCGAGACTGCGCTCTCGGTCGCTGAGATGCTCGGTATTCCTGAATTCACTGTGATCGCCGATGCCCTGCCGCATCAAAAGGTGGAC
AAGGTCCGATTGCTACAGAGCATTGGGAAGAACGTCGCGTTTGTAGGCGACGGCGTGAACGACGCCCCGGCACTCGCGATGGCGCACGTGGGCATCGCCG
TTGGTGCTGGCACAGACGTGGCGATTGANNNNNNNNNNNNNNNNNNNNNNNNNTCTAGTGCTGGTAAAGGACGATCTGCGCGATCTGTTGAACGGCATCG
ACTTGTCGCACGCCACCAACAAACTGATTCGCTGGAACTTCATGTGGGGTTTCATGTACAACGTGCTGATGATGCCGCTGGCGTGCGGTGCGCTGTACCC
GTACTTCGGCGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTCGGAGCTGCTCTCGTCGGTGCCGGTGATCCTCTTTTCGCTGCTGCTCAACTTTTG
GAAGCCTCCGTACAAGAGCCATGACGACGTGGACCCAGAGCAAGCGTTCGTCGTGGTCCAAGTGGACACGTACAGCGCCAACGAGAAAACGCCGCTGCTT
GTGCGGAAGTAAGTCAAGTCATCAGATAAGTAGGAGGGAGAAAAGCGAGGTCTGCAGCAGATTTCTATGCATCGTTCGGTTGCTTTGTTCATGTGAATAT
CACGTTTATATTTCAACGAGAATTGGAAAGCAGGGTGAAAAGCGGGCTGTAGGCATTGGACTATGGGATTGCGTACTCGAGGAAACTGCATTTCACGGCT
GCAGCATTGATGGCTGAGGTCAGCGTTCCTGAGCGCCCCGTGATTTTGTCAAAGCGCTCGCTGAGTTCTCGAATGTCAAGGTCAGGAAGCGTGCCTGCCA
AGCTTTCGGCAGTCGTCGCCGTTTCTCGCACAGCACGGACGCCTTTGATCGCTGTTCCACAGGATGCATTGCTCGGCGTGATTGCCGCTTTCAGCAGCTC
GCTCAGGCGGCAGTCAAGCTCAAACGCGTGTTTTTTTGCCTGGAACTTGGTTTTCACGTGGCTGGGGAGATTCTTCGCGCGCGTCTTCAGGATGATCCCC
AAGTAGAAGCACGCCGATGCTTCGACGCTCGCTTGTATAAACTTGGGGCGTTCGCTGCCAAGCACCAAAAGGGCCTCATTGAGCACTGCTGAGAGCTCCT
GTTCCAGCTTCCCGGGATAGTTTTTGCTCAGTGCGGTTGACAATTCGGGTGGAAGCTTGACTGGTAGTCGCTGCGATGCATAAAGCTTGGGTTCAGCGAG
AAATTTGCGTCGCATTTCCTCCGAAGCAAAGAAATACACCTTGTGCAGGTACGACGAGCGATAGAAGACTTGGCCTTTCACGATCGCTGCCCAGTCCTTC
GCGCCCGTGCCGAGCTTGAACGTCACGGGACAGTATCCTTTCATCTCGGGGAACTCGCAGTCAGCCACTGAAAGGAGACTCAACAGCGACGCGTCAACTG
GAGCTTTGGGAATCAGTGCCAGTGCGCTTTCTTCTTGGCTTGGATCGATAAACTCACTCGGACATTCGACAAACTGGTGTGCGTGCGCGGCACTTGCCAT
CCAATAGTGGATTCCTTCAAACTCTAAACAAAACTCACGAGAAGTTGCCAACGCCAAGCTATATCGCGATGAACTCAGTTCAACGGGGCAGAACGTCTGA
AACACTGGATGCCATCGTTCACGTAGCGTATCTACGCTTCGAACGACGCCGAGGAGGCGAGCTGGTCGACCAGCGACGACATCTTTCCGATACTGGCGCA
TCTTTTCGATGTGATCGTCTAGTTTCTCCTTTGCTTGAGCGAGCACGTTCCAAAACGAAGTCTCGGTCGCATTGATCTGCCGAACATGGAAGCTGCCGAA
CTGCATGGACCAAAAGTCGAGCAAATCCAGTCGCTGCTTCTGCCAGGCCGAAAGCTGCTGGATGAGGTGGTCCTGTGCAGCACTAAGCTCGGCTCGTAAA
CTCTGCTCGGTCTCGCTCGCATCTCGTTCACTGTTCTGGGTAGTTACAGCTTTGAACGTGGCCTGCTTCTTGTGCTCCCATACGGTCCGGAAGTTCCCAT
CCAGAATGAACAACAGCCCTGGGATTATTGAGGCTCGAGCACCTTTCGATTGTTTGAGATCTTCTAGATGTGGCACGTAGTCGTCCAGCACCCAACCGTT
GAGCTGACATTCAGAAGATTGCAATCGTGTTGCAATCGCTTCGTCCACAGTGCTGGCATCTGGACTTGCCCCTGCAGTCTGCGCAACTTGGACTTTCTGA
TACAGCGCAGTGCCTCCATGGCATTGAAGTACCCAATCACCTGCGGCACGTGGCGACACATACACGAGGTTGTATTTCGCACAAAGCTCGTTCGCAAATC
TCGTTTTCCCAGCATACGGGGCACCAGTAATGCAGCATGTTGGCTGAAGTGGAGGCGCAAACGAGCACGAGCCAACATATCTTGACGGATTGGATGCAAA
TAGTGCTTGAGCTTTTTGGTTGTGGGGAAAATATACACGACCCCGGTAGCGTACTGCGATCTCAAAGGCATTGATTGGTTTGCCTTCGACAGGGCATGAT
GTTCCGTGCTTCCCTACGATCACTTCTCCTGATGCAAGTGACTGGATCAATGTCTCGCGGTCAAGAAGATCGCAACGATCAAACAGTGAATCCTTCCGAG
CCATGAAGGCCTCAATTTCAGCAGCGAGTTTACTCACATTGTGCCGAAACGATCCAGAAACGTCGATCGAAGACGCTACCGCGATGCCGCGTGCCTGGAA
GCTATCTATAGCTGCTGTTAAAGCATCTTGATCGGCAGCGTACTGCTCACGGAGTCGCTGCATTTCTTCTGCCTCAGCATCCCCTAGATTGAACTCAGGC
TCTTCTTCTTCCCCATCGATGTCTTGACTTTCACTTGCCTCGTCGTCGACTGTTCGGGTTCGTCTCAACTTTGTCTTTCGTGGCGGTAGATTCCTTTGCC
ATTGGCTGAGCTGAATCTGAACTGCTTGCTCTTCAGCCAATTCTGTCGGGATGACTACGACCGGGAGCACATCTTGCTGGAAACACACTTGAAGAAGCTC
TGGAGATGGTAATCGAGAGTCATCCTCACCGAATCCGCCGAGGACTATGCATGCTGCAGAAGTCGGTGCTGATGCGTCCTCGATGACACCTCGGCATGCA
TCCATCGCACTGCAAAGCTCTTGCTTCAGCTCTTCAACGTATAAATCCGTTAACGACGTTTGGTTTTCTTCTGCTTTGAGCGACTCCACCCGAAGTCGAT
TTGCCAGAGATTGGTTGATTTGCTTCAGATCTATGTCGAGTACCTTGGTGCTCTTGTTGATCCTGGTTTGCAAGCTGCTTGCTAGTTGTGGGAGTCCAGC
GCCTCGAACTCCAAGCATAACAATGATCGGAATCAGAGATGATGTCGCAGCAGACGCCGTCGGGACGTACTTCTTTGGATTCCGCTCAAAGGTACTCTGC
TCCACCTTGCTAGCGAATGAGTAGTATCTCATATCGAAAGCTGTGACGAACTCTGGGTTGCCAGGAATCAGGATATGTTTCTCCTTCCACGTAACGGGGC
AAAAACGGCCGGTCTCGCCTTGCTCAGCCCTGAGTTGGATCGGTTCTTCTGAGGTTTCTCCATCTTCCAGCGCTGCAGGAGGAGCAAACACGGTTGCTGC
ATCTTCGGCTCTCAAGTAGCCATCATTGACTCGATCAATCCTAGGAGCTAGAGGGTCGAGTTCTCGTCGCAACGTCTCTATTGTATCAGCAGTGTCGCCA
GACAGTGTACTCACCCTAACAGCCATCCCCACCTCTTTCATCATCTCTGTAGCTGAGGCAAAGGATGCTTGCAGCTCTTGATGCTTCAAATGCACAATTC
CACCCAGACCAGTGTCCTTTGCTACTTTCTCAAGCATATCTTGGCTTGGGTCAACGAAAACGATAGCCTCTGGAAGACACTCGCGCTCTTTCAATACTGC
AATGACTTCGTTTGAAAACACCAAGTTGCTGATCATCCACTTCCTTTTACCAGCACTCGAGACTTCGTGGTGATGGATTGCGTCTGTCAGCAGCTCTGCA
GCCTGAGTTGCGGAAAGCGTCTTGCCTCCCATCATCTCCATTTCCACAGAAATTGGGGTGCGCTTTGCAAGGAGGTCGATTGCATCGATCACTGTCAGTC
CAAAGCGATCTTCAATGGCAGGATGGTATGACGCTAGCGAAATGCTGCTCACTAGCCATATTCGATTAAAAGGCTTTGCTTGTGGTTTTCTGCGAAGATA
CTGCAGCGGCCGAGAGATGAACGCATCTCGTGCCTCTTGAGTTGCCGCTAAGTAAACCCGCCCTGAAAACAATGCAGCAAAAGACGGATTCCCCAGCACA
AGGCCGCTCTCTGGAGTTGATGTTACAGGGCAGAATTCTTTCCACCTCGATAGTTGTCGTCTGTCAATCTTTGGCGGGAGCTGCGAGAAAATGTCGTCGC
CACTCGTTTGAATGCCACCATCTTCTGCAGATGTGTTCAATACGCTCCAGTCGCCGTGCAAAAGCCATCGGATCTGCTCAACACGATCGGTCGATGTGAT
ATCACCGGGAAGTGGCACCGGAATCGCTCGCCTTGAAACGTTTGTCCTTGAAATGCCCATCGAATTCTACACATAAAGCAACATCGTCAAAATACAATTA
GTTGCTTTCTCCACAACCCCAAGCCGCGCGCTGCAAACTTACTGCAGTCATTGTCCGAATGCAATGGTCTATAATGGTACATAGAGATTGCGACGCCAGA
ACGTGGATGAGGTGGTATCTTTGCTTCGGAGTATTCGGAAGATCATTCGCCAACGCCTCCAGACGCGTTTGAACGCGGACCTTGTAATCCTTATACCGAT
CTGGAAAAGATTCTAAGAGAAGAGTGCGTACTGGTAGCGTTGGTTCGCCGGGGTCTTCAACTTCGTTTCTCTCAATTTGTGATAGCTCTGGGGGAGGTGT
GGTCTCAACTTGCTCCCCATCAGCATCAGCAACTTCCTCGCGCTCTTGTTCTGTTTCTTGTTCTGTTTCTTGACCATTAGATATGTCGGCTTCTAGCTTG
ATTTCGTCCTTCTTAGAGTTGATGTCGGATCCATCGTCTGCTGCAGACTTATCCTGTCGTCGAACAGAATCGGCAAAGCCTAGCGCTTCGACGCTGATGG
AGTCTCCAGCCAGAATCGCTCGCTCCCGTGTGGAGTACAATCGTCTTGCAGATGGTGCGAGAGTAAACTGCTGCATTTGCATCTGAATATCGTCTCGGGG
TGCAGACAAAACTACCAAATAATCTGTTCCAATCTCCGTTTCGATCTCTCCAGGGTGAATATCATCCATCACCACACCAACGCCCTCTGTGCACGGTTAC
AGTAAAGCAATGTTAACCATCGGTTTGCAACTGAATACGGAGAATGACACTCACCTAAAAGCGACTTCTTAACGTAATACGTGAAGATCTCCAAGCATTT
GGTCCGGGAGAGCGCGCTTCCCGAAAAAAGAGTGTCCAGGTCAGCATCGGAGAATAATAGATCCTCTTCATGAATCGGCTCTGGGACCTTGGTCGCTTCT
ACCATAACTGGTGATTCAGCTACCAGTTCGATATTGTCGCCGACTTCTCCACTTCTCTGCTCTGATTCAGTCGGCTCGCTCTCTTCACTTGATTGAGTTG
TGGCAGTGTCGTTAGGTGCAACGGGCTCTTCATCTCCTTTAACCTTGCTTGATAGAGCAGCAGCTCGGAGTGCAGCTCGAGCGTTTTTCCGCTGAATAGC
TTCCTCAAGCGCTGTCCCTATGGAGACATATCGTAGTTTCAGTTTTCTTGCAAGCATCTTTGAGACGCGTGTCTTGCCAGCGTGCGGTGGGCCAACCACT
GCTACTCGAAACGCTGGAAACTCTTCAAGCGACTTGATCGTCGCTATCTCTGCATCCCAATCGTCCTCGCTCTCTTTATTGAGTATCCGAGACGAAGTTG
GCGCTGACGCTGCAACAAGAGCTGCTTTGCACGCATGGTCAGGGTCACTTTCATGCGTTTGCATGCGTGGGTCGGTTGCTTCGTCGAAATCCTCACTTTG
CTGGTTGTTTTTGCCTCCATTTCCTCTAAATAGCGCTGAAAACTTGCGTGAAAGTGCAAATTTACGCGGATTGTAGCACAGCAAGAGCTGCTTCAGCGAC
ATTTGCTGCGAGTTTGGTGGCGCCAGCCCACTGACGGTCTTGAGCTGATCGAGACCTGGAGGCATCTTCTGGACGAAAGCTCCGCGGATCTTGGCGACAT
CTCTCAACGGACGGAGCACATAGGATACTGCTTCGTATAGCTGCGACGAGGACAGTGAGCTTTTCAGCGTCAAGTCAATTGTTGGTTCCTCGGACGCTGG
ACCACTATCACTGCGGGCGATCTCAGAATCACTCTTGCTTGCCAGTAAACCACTGATGTGGCCATCAACCATCGCAACGCTCTCTCGAAGCTCCAAGAAA
AACGACACGTACATCGAGTGCTCACTTTCAACTGGGAGAATGAGCTCTGCGACTTGCATAAGCGCTTCGCGGAAAAGCTCCAGTGTCATCACATCGTGCG
CTTCGGAGTCGTACACCCAATCGCGTGGAGCCACTACAGGTGCTCCTTCCGTGTTGATTGATTGCACCAGCGACTTTGCAACTCGCGCGAAGAACTCGTT
GTAGTGTGAAGCAGAGAGCGTTGCTTGCGATTTCTCCTTCGCGAGGTCCCAAAAAAACACGAGATACCGCGCGACTTGTTCGTGCTGCATGATCTCATTC
CGTCGATCGAGCCACAGTCGAAGCAGGTTGGACGTCCCATCGCCCACACCGTTCTCATGCTCTTCCTCATGGAAGAGGTAGTGCCGACGCATAATGCTTG
CACTCGAACTTGGAACTAGACTTGAAGCACGCTCGATCGAGTCATAGACACACGAATGATTGCTCGAGACACGATAGAGCGGCGTTGGTTTCGCTTTCAC
GAGTTGTCGATGTATTTATATTTCCTTGATAATTTGGGGTTCGAGCGCGATTCATTGTCGCCCGGAATAACTTAATAGGGGTGGGATTGGATACTCTATC
GTCAGTCCAAATACTACATTGCGATAAGCACACTCACTTACACGTCGACTTGTCTTACTCGTTTCATCATGAACGGACGCATGGACTCATTGCAGGGGAC
GTCGTAGAACCGCGAATACTCACACGCGTTCTCTCCAGAACAATCTCTCCACCACAAGACCCACTGCGAGCTTTGCCTTTGCTTGCGGTGGGCTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTCATCGTTTTCTGGGAATATTGCACGGCATCAGAAGTTACTCTTTTCAGCTTCGGTGGCGAAGTA
GGCGCAGCGGCGTTTGCAAAGAACCATGAGTGCTGTAGCGCATCACGGACATTGAGTCTGGTGCGCGGATTGATATCAAGCAGCTTGCCCAAGAGGTCCT
TCAGTTCTTTAGGAGCATCCCTCAATAGTGGGCACGCATTGAGCGCTTCAGCACTCCCAACTTGCTCCATTTGGTGAAACAGTTGGTCTTCACGGGGTGG
GGTCTGGAACAAGGCTTGCTTCGTCCATAACTGCCACAAGACGACTCCAAGAGCCCATGAGTCTGCTTTGGAGACGTCAATAGGGATACCTGCCACAAAT
GAAGCGTGTATCTCTGGGGCGGCGTACGCCACCTTCGCGATGCCCTGTGGGCATTGATGCAGAATCCGACCGTTGTGAGTGCAGTGGAAGCGTTCCGCGA
GTCCCAAATCACCGACGCGTACTTGATCATCATCCGTAAGAAACACATTCTCCAACGACAGGTCGAGATGGGCGATCCCCGCGTCATGCAATGCTGTCAC
TCCATGCAGAATCTGCGCGAAGATCTTTCGAATCCCATCTTCAGAGACAGTGTTTAGCGCGGCCACAGGCACGCCGAAGCCTGNNNNNNNNNNNNNNNNT
TCTGCATGCGGATCTCATGTCGCATCACCGCAAGCAGATCTCCGCGCGCGCAGTATTCTTGGATGAGNNNNNNNNNNNNNNCCTTGGAGGTGGTATCCGT
GGAGCTTGACGATGTGTCTCG