Description :
From Genome Similarity Track
Location :
contig_71:21812- 26769
Transcript NameFunction/comments
g9654.t1PREDICTED: uncharacterized protein LOC101063318, partial
g9655.t1hypothetical protein

Sequence
4957 bases(100 bases per row)
GACACTGCCATTACAGCTCAACGTATCGTCGACCCGTTGTCGAAGGTTGCGTTCGCCATGTCATGTCTTGGCAGACGAGCAAGGAGTTGGGCGTACGGAC
GCCGACTCACGGACCGTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGGAGCTCAAGCTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGTG
GAGTTCCTCGATCTGCAACGGGCAAGCATGACGTGCATGCTTACGCCCAAAGAGCACAGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGC
GACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAGACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTT
GCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACGCCCCACGCCTGATGCCACGACCGGTGGTAAGGCCGTCGGGAGGTCCCGAAC
CAATGGACCTCTCGAGTGCGACAGCTGCTGGTTCCCAGCAGCGTCGTGAATCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCTTG
CGAGTGCACAGCACCTGTGCACGCGGCGAGGACCGTCGTGGCGATACTGGGTATCGTCACGGGCAATCAAAAAACTAGATGGACCAGCAGGCGCGGGGCG
CCCTGCTGGTGATGCGGTCGAGCGTGTCGACATCGGACACGCTGCAATGAAGATCGCTGCCCCCAGTGAGAGTCAATCTCACTGCAAGAAGCAAGATGAC
AAGCCGAACCTTGTCATCCTGAAGGTAAGCTCGAAGAGAGAGAAGTCTCTTCGTGCTCTAGTGGACTGTGGTGCGTTGAACAACTTTGTTCGACTGCAGA
GCCTTCCAAGGCTTGACTTCGAGAAGGTGAAAACACCTCGAAGTCTATTGGAAGTGAGGCTAGCAACGGGTGTCGTTGTTAGAACCGAAAAGCGTATCAT
ACGCGTACGCTTCTCTATCAAGAGCAGGAGTTCGTCGACGAGCTTATCGTCCTCGAACTGGACGATAAGTTCGATATGGTGTTGGGCATGCCGTGGCTTG
CACGGCATGATCCAGTGATCGACTGGACGAAGCGCACGATCGTGCACTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACA
TGCACCACGTGGTGCATGCGACCCTCCACTAGAGACAGCGCGGAATGCGGCTGTCTCCGGTCACCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGA
AGAAGATGTGAAACGAATCAGCAGGGCCTGAATTCGATCGGATTCGAGAGGGTCTCGATAGATATTGTCGACACACAATTTGTCGAAAGACACTCCGCCG
TTAGGCGTAGATGTAAAGAAGGTGCGTCGGCTCTGGGAGCCGACGCTGCAAATCCCGCACCGGAAATGCTTGCGAGCTCGCGTGCAGCCGGGCTGCACGA
CGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGTCCGCGGGTAGAACCCGCCGGCGAATACAGGGAACAACTGTCCACGGCCGGGCCTGGACAA
GAAGAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCGAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAAGCAGTGT
CTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGCTGGAGAA
TCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTGGAAGCGTTTCGCTCGCGAACTGCACGATGGACGCATCGAGCAGATCGGCATC
CTCTCGGACGTCGAGAGGATGACGTGTGAATCAGAAGAGCTGAATCAGCTCATCTCTGAGGGCGCGGACGCCCTCAGCGCGAAGTCGAACAAGGAACGCT
TCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGCGTGAGTACAAGGATGTACTCCCGGACGATATTCCTGCGGAGTTACC
GCAGGACAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTATTGTGTTACGCGACAGTGACCACTGCCGCGTGAGCAAGTCAAGGTTATC
GACGACTTCTTTGAAAGTCGTCGCAAGGCAGGACAAGTGTGGGAATCGAAGTCCCCGCACAGCGCGCCTACGTTCTGTGTGAAGAAACCACAGGGCGGGT
GGCGCATCGATTCATGCGTATAAACAAGCTGAACGATGCGACGGTACCGGCGCAGACGCCGATACCTCGAAAAGATGTGATCATCGATTCGATGACCTCG
AGTACTATCTTCAGTACTCTGGATCTGAGAGACGGGTTCTATCAGATCCTCATGCGTGAGAGTGATATCCCTCTCACAGCGGTAAGCACTCCGAGCGGCA
TGCTCTGGGAGTGGCTCGTATGCCGCAGGGACTGAAGAACGCCCCAGCGACGTTCAACAGGTGCGTCACGCACTTGTTGCGCTCGGTGCGCGACTTCGCA
CCGATCTATTTCGACGACGTGCTTCATTCACAGCCGGGCTGTGTAATGGGAGGTCGGATGTGGAGATGCACACAGAGCATCTCCGCAAGTTGCTTGAGCT
CATGCGAAAGCACAAGCTCTACGCGAACCTGAAGAAGTGTATCTTCGGGGCGACCGAGATACCCGTACTTGGGTGTCTCGTGGGGAAAACGGCGTACGCC
CTGACCCAGGAAAGGTCAGAGTGATCAAGGAATGGCCTACGCCTTCAAACGTAAAGGAACTGCGGCAGTTCCTTGGACTCGCCACGTACTTGTGCAAGTA
CGTGAGAAACTACGCGGGCAAGATTCGCCGCTGTCGCACTCTTGAAGAAAGAGCTGCATGGGAATGGACTGCTGATTGTCAGCAGGCCTTTGAAGCAGTC
AAGCAGGGCTTGACTGAGGCGCCGATCTTGGCGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGCGATGCATCCGATTTCGCGATCGGATGCGCAC
TGATGCAACTCGATCACGAAGGTCGTGATCGTGTGGTTTACTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGCAATTACCCGGTACATGACAAGGAACT
CCTTGCCATGAAGTATGCACTCGCAAAGTTTCGAGTGTATCTACTTGGGAGTAGACCATTCGTGGTCTACACCGACCACGCATCGTTGCGTACGGCGACT
AAGTCGCCGCACATATCCAAAGAATGGCACGGTGGCTGTCATTCTTTGCGGAATACAACTTCCAGGTTGAGTATAAACCTGGAAGGTTGAATGTCGTGGC
CGACGCGCTTTCGAGTCGACCAGATTATGCGGTGCAAGAGGCCGACTACACCCTCGTCGTCCTTGTTGGATGACGTGAAGGCCGCATACGCGCATGATGC
GGATGCGAAGCAGTTGTTGGAGTACTTCTCCACACCTTCTGACAAGTCTCGTCAGAAGCTGGCCAAACACCTTCGTGCCCGCGTACACCGTTATCGTGTA
CACAATAGTCTGCTGCTTTACAGCGCAGTCGACGACAACGCAGATCGCATTGTCGTGCCGATGATCATGAGTTGAAGCTCAAGATCACGTACGAGTACCA
CGATGCCCCGATCGGGACATCCTGGCCGTGAGAAGACATATTTGCTTCTCACGCGTGACTTCTACTGGAGTCACCAGTACAAATGGGTACGCAAGTACGT
TCGTGCTTGCGAGGTATGCCAGCGCGTGAAGCCTGCGCCCAACTCGCAGACTCCGCTTCAATCACTACCGACTCCGTCGGAGTGCTGGCAGTCCATTTCA
ATGGACTTTGTTTTTGGTCTTCCGCAAGACAACAAGCGGAGGACTGGTATTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTGCATCTTGCTGTAGTAC
CAGCCGAGGTGACAGCCAAACAGACGGCATGTCTGTTTGTCGACTGGTGTTTAGACACCATGGTATGCCACTCGACATCGTGTCGGATCGGGATCCGCGC
TTTACAGCGCGATTCTGGCAAGAAGTGTTTACACTTCTTGGGACAGTGTCCATGTCGACTGCGGATCACCCGCAGACCGACGGACAAACAGAGCGTGTCA
ACCGCGTGCTGGTTGACACCATGAAGAGCTACGCGCACTCGTTCCATCAATGGAGCGACTGCTTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCA
TGTCTCGACAGGACACACACCGTTCTACGTGAATGCCATGAGGCACCCACGCGTACCGAGCGTACTCGGTGCGGTAGCTCCTTCCTTAAGTGGGGGAGGG
TATCCGGTTAATCCAAAACAACCGGATAAGCACGCTGATACAAGCAATGTATCAGCTGTGACGACTCGCGCACGTACTGCGCGCAGTCATGGCGACGACA
AGACAGTGTCTACGACGGGCGTAGACACTTTAAACGACAACGAACATCACGCACAGGCCGGGCCTGCTGCGAACAAGGAGCACGAACTGAACCAGGGGTT
CAGCTCGGATGCAATGGACTTTGTCCAGCGCGACAAGCCGTAATTCGGTTTGTCCAAGATGCAATAGCAGCTTCTGTCGATCGACAGAAGCTGAATGCCG
ATAACACCGGCAGGGGAAACACAAATGAATTCAAAGTTGGTTCATTAGTTCTGTTAGCTACGCAGAACCTAGCTAAACATGCAGTTTCCGATTTCGGAGC
AAGCAAGCTTGCTCCGCGCTTCATTGGGCCATTCACCGTGTTGCGAAGCATGGCACGCGTACACACTGGACATACCGTCCAGCATGCGCTTGCACCCAAC
GTTTTACGTTGGGCGACTGAAGCCGTACGTGCAGCACGAGTCACCTACGTCTGGTGA