Description :
From Genome Similarity Track
Location :
Scaffold_36:2181- 3185
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_08164Hypothetical protein

Sequence
1004 bases(100 bases per row)
AGGTAACGCATCGACAGACAATATGTGCACCAAGGTGGGTTGAGGTGCAGAAGAGCGCCCCAAGCGGAGCCTCTCACCTGTCCACTGGCTTCCGCGCTCC
AAACTTCCGCGCTCCAAACTTTCAGTCAGTGAGTCACGCCACATGAACGGGGCGTGATTTGCCTGAGCAGCGGCCAAAGGGTCGTCGAGTGGCATACCTT
TGAGCACGTAGTACTAGCAGAGCAAAGTGGAGAGAACCTTCCTTTGCAACCACCAAGTATTTTCCTTCTTATAGTGATCACGAGCTGTGATCAGTGCGGC
TCTACGATATAGCACCGCATCTGATACTACCCAGGCTGGTACACCTCCGACCTGCGCAAACCGATCAGCTCTGACGCTGCTATACGCACGCCATGGCGTT
GCGCACGGGTTCAATTGAATGATCATACTATCTGCGTCGTTTGCAAACTGCTGGGTGGCGTCTCTCGTGGGGCTGTCGGGATGTATTAGCTGCGCGTCAT
TGACGATTCTAAAACCCGGTTCCCTTCACCCATATCTTTCGCCCCTCGGACAGAGCCTCGCAGAGGTTTCTACGCTCCACCTCGCTCGCGCCATCGAGCG
CTGACCCTTGTCGCACCGGCGCGCTTCCAAGATTTGCACTGGTCGTGCTGGTCGTGTGGCAAAGTGCAATCTCATTACGCGCCTGTGACACATCCAGCAG
TTGGCCAATCACAGTGCCCTTTCGTCAACGCCAGCAAGATCAACGGTCACTTGACCGACCAAGCAGCCTATACATATATCGTTCAGGCACGTACGCTGTG
GCTTGCCAAGCGCGTCGCACGACCGAGCATGAGATAGCCAAGTCTATGGCTCTGGGGACATAGATCCTCTGCCGCAGCTCTGCGCGTGAGCTTGTTGGCT
TCTCGGGAGGGTGCTGCATATTCACTCGAATATTTGGGCGTATCCGGTCGCGTGACACAGCACAACAGGACCTTCCGGCGCTCGAGCAACACCTGCTCGG
TCGA