Description :
From Genome Similarity Track
Location :
Scaffold_8:218097- 229908
Transcript NameFunction/comments
Phyci_211510Hypothetical protein
Phyci_532372Hypothetical protein
Phyci_90135tRNA pseudouridine synthase
Phyci_90136conserved hypothetical protein

Sequence
11811 bases(100 bases per row)
AACAGCTTCTTCACGCCCGTGTACTAGCAAAGCGAGGAAGCAAGCACAAAGTGACGGAAGAACCCACGCAAGCTGTCGTCAAAATCCCAGCGCAAAATGA
TGAAGTGATAAGTGATTCTCTCCTGCCTGAAAAGCCTGTTGTAATTTCACCGATACCACCTCATCTTCCACCACTACCAGTAGCAGCCCGTATCACTGCG
GAAAGCTCTAACGCGCTGCGCCGTTCCTTACCAGTGTTATCACTACCAGTAGCAGCCCGTGTCACTACAGAAAGCTCTAACGCGCCGCGACTTTCCTTAC
CAGTGCCACCAAATCTCAAGGCTTCGCAGTGTGATCGTTTTCGCAGTGACAGCGTTCTATCTTCTCGAAAGCTAACAAACAACTCACTACTCCCCACTTC
GAGCAAGATATTTCCTGTTATTCCTCAAAGCACGGTAGGTCTTGGTACTGCTACGACAGATCAATCGCCAGCAGGAATTCGTCGAAATAGCCGGCGGGCG
TCATTTCTTGCCTCTGGTATGAACAGATTAACTATGTTTCGCGATAACTTGTTCCATGAGAACAAGGTCAAGCCGTCTGATGCTATCCAGGGTTTCTACG
AGCAATTTCCCCATCTCGCGGCATCTTCAGCTCCACGTCACCGCTGGTGGCATCGTTTTCTTATGAATCGGGGTCTGGATGCCGAGTCGCATTGGCGAAT
GCTGTGGATTGCTGTGGTAGTCGCGGTGACTTGTTACAACTGGGTGATGATTCCGTTGCTACTTTCGTTTACAGCCTTGGACGATTTGTGGTCAAATGGT
TTTCTCGTTGCGCTCAACATTGTGACTGATATCGTGCTCTGGGCAAGCGTCTACAGTAGCCTGCACTTGTCTTTCTCTGTTAACTCCGAGAAGATTTTGG
AGCCCACACGGACAGCTGAACGATACGTAGCAAGTGGGCGATTTCTCCTTGACCTATGCTGCTCATGGCCTTACTGGATATTTTTCCCGGCCATGTTCAC
TCACCCTGCGCTCCGGCTTCCCAGGTTAATCGGAGGGTACCGATTGCGTGGATATGCTGCCGAAGTTGTTGCGTACTTTCGGCTAAATAGTCGGCATAAG
CTGATGCTTCTTGGGGTGTTGTTTTTGATGCTGTACCATATTGTCGCCTGTCTGTACTTCAGCACGACATATCTGGACGGCTTCAGTGCAGGCGAAAACC
AGTGGCTCCCGTCAGAAGATTTGTATATTCAGCGAATAAATGCTACTCATTTCGAAACAATTTCTGGGGCTGTCCTTGCCGCAGATAGCACTCAAGTTCA
AGAAATACGTGCTGAACAATATTTCCGATCCCTGTATTACGCTGCTAACGTTTTGGCTGCAGTCGGCCGAATGGTAGAGCCTACGAGCGATACAGAGTAT
GGTGCTGCATTGATATTTATGCTGAGCGGATTTTTCATCACCGCGATTGTCGTGGATCACGTGCAAAAAGGTTTTACCGCTTCGGCGCTGGAGCAAAAAG
AGTTTTTCGCGGCACGCGCGCGATTCCAGCGCTTCCTCAAGCGCCAGAACGCCCCGCTTTCTATTCATCTACGCGTAAATTCTTTCCTGGACTTTTGGTG
GTCTGCTCATCGCGGTGCTATTATCGACGAATTGCTCGAGGACCTCCCAGCTGCCATCAAGCGCGATGTTGTTCGCAGCATTTGTACTCCAGCGATGGAC
TCGTTAGAAATGCTTTGCAATGCTACGGCAACACCTCCCACCCCTGAAAACGACAATCCCGAACCTATACAGGAAACCACTGAAGCGACGACCCTCGAGC
ACTTGGAAGATATTTTCCTAGATAACCTGAAGTTTGTTCTATACGGGCAGGGTGAAATCATTTATCGACGCGGCGACTACGCGGCTGGGCTCTTTTTCCT
GTTGGAAGGCAAAGTCTCGGTTTTGCTTGATGGTGAAGTTCCTCGTCATGTTCCGCTCGGTGGGTTTTTCGGCACAGCAGCAATTCTGTCAACTACCTCT
CGCGATAGACGCGAGAGTAGACGGCGCTCTAGCGTTAGGTCTGCTACAGGTGTTGGGTACGCTGAGCGCGTCACTGCTGTGAGTGGCTGCATCGTCGTGT
ATATATCACGTGAACATTTGCATGCGATGCACGGCCTATTGCCAACGCTTCCAGAATGCTTGCGCAAGTTGGAACAACGACTACATGATGCCCGCGTCGC
CCGTTCAGCGGACTTAAGATCATTTCAGCCACGAGTGGTACTGGGTTTGAATAACCCAACTATGCGCCGAGCACTTCGACGCAAACAATTAAGTGGTCTC
GTGCAATTGCTAGCGAAGAATCTGGAGTGGTGGCAGCGAGGCACAGCAGTGGACCCCGACTGGCCGTTTGTGGGCGTATGGGAGGCGACTATGCTAATGG
CATCAACGCTGCAAGGAACACTGGTCATGTTTTACATTTGCTTCGGAGTAAATGAAACCGCACATGGACGTGCCTTTGCCGATGGAGTTATGGTCGCACT
CGAGCTCTTGTTTGTCCTTGATGCGTATCTCCACTTGCGGTTGGGATTTTACGAATATGGAAACAAGGTGATGGATCTCGTCGTGATCCAGCGCCGCTAC
TTGCGCTCGGTCTACTTCGCAATTGATATAGCTGCTCTCGTCCCGCTGTTTATCCTCAACTGGACACTGACCACAAGGCGCTTGGAAGTACTCAACATCA
ACAAGATGTTCAGGTACTTCAAGGGATCAAGCCAATTTCGTACGCTGGAAACAAAGTACGTGAAGCTCACGACTGAACTCAGACTCCTCAAACTCGTGTA
CTATTCGTTTCTTGCTTCGCACATGTTTGGATGTATCTGGTTTGATTTCGCAGCCCATAAGTCTGGGATTCACATGGTTATGAGTGGTGGCAACGATTGG
TCGCCAAGCTTCGGGGCATCGCTGTGGGGCCCGTACGAGTCATTGGAGTCGGCTGCACGCGGTCTTCAGTACCTAGCGTCAATCTTTTGGTCCTATGGTT
TGATGTCCAATTCGAGCCAAGGCGAGCTGCCTAAAACTGTGGGGGAGTGTATCTTCAGCGTGATCGTGATGACGACGGGATTTTTCCTCTTTGCCTACGT
CGTTGGTCACATATCCGACTTGATTGAGCTGCAAGACTCCGAAAATCGACATTTCGTGGCGAAGCTGAGTTCACTGCGCCAGCTTCTACGTCACTTTGAC
TTGCCACCGCGCGTCGAAGAGAAGTTCAAGAAGTACTTTTTCTTCAAGCGCTTTCATTCCATTACGCAAGAGCACGTACTCGAACGAGTGCTTCCACCGT
CACTGGTAGTAGATATGCGCATGTTTCAGCTGCAGCCGATGATCGTTAAGGTAGCATTTCTTGTTGGAATGGAGGATTCAGTCACTCGCATGCTTGTGTC
GCTTTTTACTCAAGTGTTGTATGTCAAGGATGAATTCATATGCCACTTTGGAGAAGAAGGAAGTGAAATGTTTTTCATTTACACGGGTGTACTCGACATA
TATATCCCATTGCTACCCAACGGAGGTGGCAGTGCGGCAAGTGGTCGTGCTACTATCTTCCCTTCCGCTCCTTCCGGTGCTCGTGTCAGTCTCAGCGGGC
TACGCAAAGTAAATGAGATCACTGCTGGAAGCTACTTTGGCGAGGCAGCTTTATTTACGAATACGCCGCGTAATGCCTACGTGAAAGCCAACACGTCATG
CATCTTGTATAAGTTATCGCGCCACTCACTGGAGTTGGTATTCGTTCGCTACCCTGAATGGCAGCAGAAGGTTTTGCGGATCGTCAAAATTCAGCAGCAG
CAACAAAGATTACAGCGCCTGGCCTACGAAGCACAAGCGCCCGATGGCGGAGCCTTAAACCGCCGTCGTGGACTTCGCCGCACTGCTTCGCGTATGGACC
TAGTTAATGCTCGAGCGGAAAATATCGAGCAGCTCCTTCTAAGTCACCGAAAGGGACCAAACTCATCGGAGGACGCCCCGCGTCGGTTGAAGACTTGGAT
AGTTCAGCAGTGGCGAAAGCTCCGGGCAGCGAAAGTGGTCGTACGATGGGTAGTTCCAGCTTTACGTTCACTGCAGTCAGTAGCAAAACAACTAGCGCAT
GGAGCGGAGATTCAAAGCCCATTCTACCTTCAGTGGATGAGATTGGTGTCTATCTGCACAATGTACGTGGCCGTGATGGTGCCATATCGTCTAACGTACG
ATTCACTCGACCGGTGGAACGTGATTCCTGTGTGCTTACGGATTATTGAAGCGCTATGCGAGGTGGTATTCTGGCTTGATATTTGGTTTCAATTTCATAT
GCGAACGAACCAGGCAGCTATGGAACTGTATGAGCAGGACCAACTAGTGGGGTACAAGCGTGAACGGCTTGCTCTCGATTTGGCAGCTACATTTCCGTTA
GACCACTTTGCGACCAGCTTTTCGAGTGGACCTTACCGACTAATGCTGTGTAAATGGTTGCGCCTTAACCGCTGCTTGAAAGTTATCAATATCGTGTACT
ATCGCAATGAAATCACGCGACGTAGCGTATCATACGAGGTGAATCGCGCACAAACTCTGTTGCTGTTGTATCTATTGGCGATGTTTTGGACTTCGTGTGC
GTATTTCGCGGTTTCGATATACGATGGTTTTGGCACGGAGTGGCAGGACTGGCTGCCGTCGTCTGTGCTGGATTCAGATGACCCATCGCCAGATTTATTG
ATGTTGAGACTCTTCCGAGGTTTGGCGTTCGCGGTCACAGCGTTTGTGAAGAAAAGCAGAACGTTTGTGCCCGCATCGCAGCTTAACTTTGGTTTCACGA
TTGTGATATCATTCATTGGCCAGCTGATCATGGCCCTCATGATCGCTGAAATGGCCAATGTGTTTTTGCTGTACATCGATAACGAAGTGCAGTTTCGCAA
AAACCACCTCATCGTCGAGCGCTCTCTGGCACGTTGGAAAGTCAGCACAGCGCTGAAGCAGCGTGCTGATAACTTTCTCACGTCGTGGTGGTCCTCTCAC
GCAGGAGTTGACTATCAGCTTATCTTCGAAGACCTTCCTGCAAGCGTTCGAACCGAGGGCATCATGGTCATTGCCAAACAACCACTCAGCTTGTTCATGT
ACCGTGTCTTTCGTCCGCTGATACGCGGTGGAATTCATGGTGATGCGGACACTGAAAGTGGCGATGCTAATAAGGGCGAGGTCAAACCTAAAGGCAAAGG
TGCTGGTGCAGAAGTAGTTGAAAAACCTGACTACAGTGTCAAGTTCCACCTTGCCAACCTCACGTACTCAATCGCCAAATTCCTTCGGTTTGAAGGATAT
CCTCGAGGAGAAGCAGTCATTGTGGAAGGTAGTGTGTGCAAGGCCATGTATTTCGTGGTTCGCGGATATCTGTTGTCCAAGAGCGCGTCCAATCCGCTGA
TGTACCCCGCTAGCCGCTTTCGAGGAGGAGATTATTTCGGCGAAACTGGAATACTTGGTCATTCCGTAAGCCTCATGACGGTGACAACGATCCGTGCTTG
CGACCTGTTCGTCCTGAAGTCCGATCACCTGCTACAGGTGCTTCAGTCACACCCGTATTTTAAGCTGGTATTGGCAACTGCACAACTTGCTGTAAAACAG
AAGAAAACCTCGAGCAAGTTTGTTACCGAATGGTTAAGTAGcaacgatgacgatgaagacaacgagagcagtgatagtagtgacggtgacagcgacgatg
aagacggtgaggatgaAATGGACGAAACCAACACAAACGAAGGAATCGTGAGTGAAAGCGCGAAGCTGAAGCAAGGGAGTCAACAGCTGAAGCGGGCGCT
GAGGGGGGCGTCCCCAGAAGTGATGGAGGCGTGGGAGGACACATTTGAGCTTTTCATGGAACTGCTAGTTCCGAAGGGGAGCATGGGCACTGCAGATACC
TTCACCTAGAGGCTCGCAGCCTATCAACTTAGAGCGAACCACCGAATAATTGACGCAGTAGCAGAAAGTTTTGATTACTAAATAGTTTCAGTCATCCGCC
TCCATCATATCTTCGAGGCGCATAAGGATCTTGGTCAGGTTGCTCAGCTTGGTCTCGAGCCGCTGCTCTGTTTCAATAAGTCGCTCCTGGAAACTCTCCT
GCATATCGAGTAGGCGAAGCAACAGCTCATTGTCCGGCATGATTAAATGAGATGAGCTGCTGGACACTGCTAGTGTTGGCTGAGCGAGGCCAGCCAAATC
ACCACTAGGCCCACTTTGAGGTATTGCATCGATAGCTGCATTTGTGTCGACATTCCTTGGATCAGGGGTGGCAAGAGTAATGCGCGAGGCCGAAGGATGA
GACACGATGGTGCTAGAATAGCGGTGCCCAAAACTGTCTGTGCGGGCTTTGCTTTGCAAAAGCAGTTCTGTCGGCGAGGGCGCGGTGGTGACAGCGCCTG
ATCGATGCCTTGTATGTGTGGAGGACGGGCGGTGGTGCTGATGGAGACCAACGCCAGGCACGACTAGTTGATTCATAAAGGCACGATTTTGCAGAACCTC
AAGGTCGTTGCGAAACTTGGCGAGTTCGTCGTCCTCAAGCATGCCGCTGTTGTCCGTGTCGTACACGTTAATTATGTCGTCGATATCGAGATGAATCCCT
TCTGTGACAGCATGAAATCGCTCCAGGATGGCCTCGATCTCGTTGCGACAGAGCATGCGCTTTCCCTTGAGGAAGTCCACGTTACCCTTCATGGTTTCAT
GCATGACGGATTTCATGACTTTCTGGAAATTGGTGCCGATGACCGTGATAGGCAGCGCGAGCACCAGCATTCCCGCGAGAACAGTGCAACCCCCTACCAC
CTTGCCCATCCAAGTCACAGGCGTCATATCTCCATACCCCACAGTTGACATGGTGACGATACACCACCAAAAGGACGTGGCGATGCCTTGGTATGGGTTT
GGATCCACGCACACGCAAGCCTTGCCAGTCTCTACCGCTGCTACCGCGGCGGCTACAGATACGGAATAAACCACATCGGTAGTATTAATGTTTCCAGAAG
AATCAGTGTCACACTTGCCCATCCATCCGTCTGCACGACAACCATCGTTTGTATACTCGGCGAAGTAGATGGCAGACGAGAAAATTATCATTGCGATCGA
CATGAGGAATATCAGCATGGTCAGCGGCTTTAGGCTTATGGCGATGGCCTGTGTGAAAACTTGGATTGCAGACGAATACCGTGACATCTTCAGTACGCGT
GCCACACGAATAAGCCGCACAATACGAATGGCCCCGAGGGACCCAGCCTTGTCGATTGCCAACAGGGACTCCATGTAAAAGGGGAAGACTGCCACAAAGT
CTATCCAGTTGGAGTAATCTGGAAGTGTGAAGGAGATGTCGTCAGTACATGCATCTTCGACGCATAAAACGGAGACCAATTACTTACCTCGGAGGAACAT
CATTTTACTGGGGCACACGAGAAAACGACTAACGAGCTCAAACGAGAAGACGGCAGCACAAATTTTCTCCACACCGTTAAGCTCTGGCGTGTAAGGATCG
AAAGCAGCCTCCGTTTCAGCGACAAAGGCGAAGGTGGACAATACGATGAATCCATATATGCTCAGCGAGAAGTAGTACGCGGGAGTAGACGACTGAGGGT
CCTCGAAGAAGACCCAGATCTTTTGCATGCAACTCATAGGCTCTTCAGTGTCGTCAATGTGAGAATCAACCTTCGAACCTTGTCGCATTAGATTTCCCTT
TGCAGCTTTGGCTACGTCGACAGGTAACTGAGGATTACTGGTTTCCGCTGTTGTGACTACCATGGCCTCCTCTGGTGTCGGTGTTACAGACATAGACCGC
CGACTGCGTACGCTCCGCTGGCTTCGCTGACTCTCCACAGTTCTCATCCGTGGAAACGACGGGAGATGAGATTGAAGTCGGAATATCCGGGAGCTGTGCA
GCTCTGTTCTGCGTCTGGCTTCGCGTTCGATCACCTTCGAGAGCTTCAAAGCTGTTTCTGAGAGCTCGACGGGGCCTCCAGAATCTCGCATGGTGATGGC
GCTGCTCTTGTGCTTCGATCAAACCAAGCAAATGTCACCAGTCTACAGTAAGCGTGGCGATGGTGACCTGGACGCGTCCAGAGCACCCTCACGCTAAACA
GCAAGCTGGGCCCCTTTCACAAGAAAGGCACACATGGCACAGCAGTTAGTCCTAAAAATATGCAATGGTTTCGGAGAGCAACACGTTAGTATTATTGCGA
AAGCTCAGCCCGAAGCTGCTATGTCTGGAACCTGACTTCTTGGACCAACCGCGTGCAGCCATCGACTCCAGCAGTCTATTCATGAAATGAACAAAATGAT
TCAAAGTTGTGCAGTCATCCAGAGCTGCTCTCAACTGGTGGCCGATTCCTCCTCAGGCTTGGGAACTTCTACTGTCGCTAGTACCTCGGTGGTGGTATTA
GCCTAAGCAGCAATCTCCGCTCGCGCTGCTTTGGCCAATTCCCGCCTACCCGCACGGTCAGTGCGCTCTGCTTCCTCTTCCTTCTCCTTTTTCCACTCCA
AGTACGGCTTAGCCACGTAGTCGAACGGCAATACCTCCATAGTGCGTAGCCACTTCGCATACGTGCGAGTGCGCTCTTCGTGCTTCATAATATGGTCAAA
GATGAAATCGCGCTTGAATTGCTCCACCGCCGCAGCAACAGCGGGCTCCTTCAGGTCCAACGGTGGGTGGGACGTCTGAATCGACTCGGCCATCTTTAAG
TTGTACACCTCGAAGTGTGCTTGCGCCAAGTACAGACCTACACTAGGCGCCTTGGGCAAGTCCATCTTGGTCAGCTGCATGGCGCGCTCGATCGTCGAGG
GGTCCGTGACACCAGACACGATCTCCACGGCCGTGCCGATCATCTTGCGGATGTGGTGCAGCAGGAAACTCTGGCCCACCACGCGCAGGCGCACCCACTC
CATGTCGTTCTGCACGAACGGGCGCTCGGCCTCGAACGAAATGATGAAGCGATTGGCCTGAGGGTTGGTGGGCTCCATCTTGGACGTGAAGTTGTGGAAG
TTGTGCGTGCCCACGTACTCCTTGAGCGTGGCGTTCAGCTTCTCCAGCGTCTCGTCACTCAGGCGGAAGGCCTTGTGCGCCTCCAGCGTCGTGCTGTCGA
TCACCACGTTGTGGTCGAAGCCCTCCTCCGAGTCGCGGAGGTCCGCGGGCCACTGCGCCGCGGTTTCTTCTCCTTTCTCCTCCGATTTTCCGGCTTCCTT
CCCGCCGGAGCCGCGTGCGCGCTGGGCGAAGATGAAGGTAGGCGCCAGGTACTCGTACGTGCGCTGGTCGCACGTCATCTTGGCGTTGAAGTTCTTGGTG
ACCGTGACCATGTGCATCACGCGGATGTCCGCGGGCAGCGCGGCGTTCACCTTGGCCACGAAGCCGGCCACGTCGTCGCCCACGTGCAGCTTGGCCGTGA
GCAGCTGGCCCGCCGCGTGCACGCCCTTGTCCGTGCGGGCCGCGCGGCTCCAGCCGATCTTCTGCAGGAAGCCGAAGTTGCTCTCGGCGATGCCGCCGGC
CGCGAACAGCGCGCGTTCCAGCTCGGCCTCGATGGTCTTCACGCCCTCGTTCATCTGCATGCCGCTGTAGTTCTTGCCGCAGAAGGCCACCCACAGGCCG
TAGCGGCGCTTGGTGGGCAGCGGCTCGGACGCATCGGCCGCCGGCCGCTGCAGCGGCCGCTGCGCCGCGTACGAGCCTGGGTGCACGGCCTCCGAGCGGT
CGGCACGGCGGTCCACCCGCGTCTCCTCCGGCTCGTCCGGCCGGCCCTCGCGCCGCGCCTGCTTGTTCTTGCGGCGCACGGCCCAGTGCGTCTTCTTGCG
CTTGCCGGCCATGGTGTCCGCTGTCGAATGGCTGGCAATAATGGGGTTATTGCGAGTAATGAAAACGGTGGGAAATCGAGTACGGTGTACCGCACATTAC
ATTATTGTGTGCGGCACACTAAGCTTGCATTAATGTGTGATCCACACCAACCTAGCATTATTGTGTGACGCACACCAACCTTATCATTCTGAGGGTCGAA
GCGGTCGGACGGCGGTCATTAGCCAAGTCTCAGCGGTGGCAGCACGTTAGTTCTTAGGTCGATGGTGTCGCTGCGCAGCCTGCAGACGCTGCGCCGCGCG
GCCGTGCGCGTGGCCAACAGCCGCCTGGCGCCGCTGCAGACGCTGCAGGCGCGCGCGTTCTCCCAGGCGCAGACACCGAGCGCCGTGGACCCCAAGGACA
TCCTGCGGCCGGAGCTGTCCGCGGACGCCAAGCCGCAGCTGTCGCTGGAGCGCGAGCTGCCCGGCCTGCCGCAGCTGAAGCCCGCGAGCCAGCTGAAGCC
CCCGCAGACGGAGATCTCGGTGCTGCCCTCGGGCCTGCGCGTGATCTCGCAGGAGACGTACGGCCAGGCCGCCACGCTCGGCATCTTCATCGACGCCGGC
AGCCGCTTCGAGGACGACGAGAGCGTGGGCGTGAGCCACCTGCTGGAGCACCTGGGCTTCAAGAGCACCACGACGCGCTCGCACGCGCAGCTGGTGCACG
AGATCGAGGACATCGGCGCCCTCACGACGTCCTCGTGCGGCCGCGAGCAGATCATCTACACGATCGACCTGCTGCGCGACAACGTGGAGAAGGGCCTGGA
GCTGCTGGCCGACGCCATCCTCAACGTGGACCTCGTGCCCGACGAGATGGAGGGCATCAAGGCCATCATGCGCATCCAGACCGAGGACCTGATGGAGAAC
CCGCCGGCCATGCTGCAGGAGTTCATCCACGCGGCCGCCTACGGCGCCGACACGCCGCTGGGCCGGCCGCTGCAGTGCCCGCTCGACAAGATCGACGCGC
TCACGGTGGACAAGGTCAAGAAGTTTCGCGCCGAGCACTTCGTGGCGCAGAAGATGGTGCTGGCCGGCTCGGGCGTCGACCACGCGCGGCTGGTCAAGTA
CGCGGAGAAGTTCTTCGCCGACGTCCCCGTGGCCCCAGCGGGCACGCCCATGGCGACGCCCTCGAGCCCTGAGACGCTGGAGCCCGTGATCTACACGGGC
GGACTCTACCCGCTACCGAACCCGGAGTCCGAGTTCTCGTACGCGGCGCTGGCCTTCCCCACCGGTGGCTGGCACCACGAGGACCTGGTTCCTATCTGCG
TGCTCCACACGCTGCTGGGCGGCGGAGACAGCTTCTCTGCGGGCGGGCCCGGCAAGGGCATGTACTCGCGGCTGTACACGAGCGTGCTGAACCGCTTCTA
CTGGGTCGAGTCGGCCTTCGCCTTCTCGTCCATCCACGCGGACGTGGGTTTGCTCGGCATCTACGGCGCGTGCCTCCCGTCGCACACCAGCAACCTCGTG
GCGCTGTTGTGCAACCAGATGCTGAGCGTGGCCAACCGACCCGTCGACGCCATCGAGCTCGCGCGTGCCAAGAACCAGCTCAAGTCGTCGGTGCTCATGA
ACCTCGAGTCCCGCATGATCCTGTACGAAGACATCGGTCGTCAGCTGCTCACGTACGGCGAGCGGGAGACGCCCGAGTCTGTGTGCGCCAAGATCGACCA
GGTCACGGCCGCAGATATCCAGCGAATCGTGAAGGAGGCTATGCAGAACCCGCCCAGCCTGGTTTACTCGGGAGACATCCCTCGGTTCCCGCAGTATCAG
CAGGTCGTGGCTGGCATTAAGGAAGGACTGAGCGAATGAGTGGGTGCATTCAATCGAGCAGATCAATCCGGTTGAGTGGCGAGGACTCCATCCGCCGTAG
GTAGGCGAGATGACTAAATAAACAGTAGGAGGAACTTGTTGCTCAGCCAGAAAGGGAAGAAAAGCAATAGAAAAAAGGCAAACTGGAATTATATGGATTC
GTGGATGCTGG