Description :
From Genome Similarity Track
Location :
scaffold_2:2180093- 2183007
Transcript NameFunction/comments
Plaha_PHALS_06954Elongation factor-type GTP-binding protein

Sequence
2914 bases(100 bases per row)
GCTTTGTCGCTGGGTCCATTTGAAAAATCACCTGAGGAGCCGAGACCGACATTTCGAAACCTTCACGTCGCATTTCTTCTATCAATATCGCAAGTTGTAG
CTCGCCACGACCGTGAACATCAAAAGCTTCAGAAGAAGCACTGGGTGATATGGAAATGGCAACGTTGTTCTGAAAACGGAAATGTTATACTGTAAGCAAA
TCGCCCGTTTTGGTGGTAATCGAATCGTACCTCGCATTCCCGTTCAAGACGCTGCTTAATGTGAGAAGATGTGAGGTATTTGCCCTCCTTGCCTGCTGTT
GGCGCATCATTCACACCAAACGTCATGGAAATTGTTGGGGGGTCTAGCTGCGGAGATGGGATGGGCTCCGTCACAGCGTTATCAGCAATCGTATCAGAAA
CATAGGCATTTACGCCTGCAATAGTAATGATGTCGCCTGTTGGGGATTGCCAAATGTACCGCATATAGTGATAAGAAAACCATACTTATATTGAGCGTGG
CAATCAACGTACCAGCCGTAGCCGATTGAATTTCTGACTTGATAACTCCTCGTGTAACAAACATCTTTGTAACTCGGCCACTTTCGAGCTTCTTGCTATC
GCGATTTAACACTTGAATCGAGTCACCAATCTACTTGGTGCATTCGAAACACAGAATAATGCAGTCAGACTTGAAAATTAATTACATACAACCGAATAGA
CTAGTACACCTTTACAGTTCCAGCGTGGACACGACCTGTGGCCAGGCGACCAACGTACGGATCGTGGCCAATCATAGTTACAGCCATCGCAAACGGCATA
TCAGCATTGGCCTGAGGGGCAGGCACATAGCGCATGATCTCGTCTAGCAACGGACGCATACTGTCGCGCGGCTCGTCCACGTTATCAAGGTCATACACGG
CCCAGCCCTGTTTTGCCGATGCATACAAAACAGGAAATTCCAGCTGTTCATCATTGGCATCAAGAGCCACAAACATATCGAAAAGTTCGTTTTCTACCGA
GCCATCCAGGCGGCTCGTGTCGCGGTCCACCTTGTTAACTACTACGAGCGGCTTCAGGCCGCGATGCAGCGCCTTAGTCAGTACGAATTTAGTTTGCGAC
ATAGGGCCTTCTGTAGCGTCAACAACCAGTACCACACCGTCCACCATACTTAAGATGCGTTCCACCTCGCCGCCGAAATCAGCGTGGCCAGGTGTGTCGA
CAATGTTGAGCACGTGGCTGTTGTACTCAACGCGCGTGCATTTGGACATAATTGTGATGCCGCGTTCGCGCTCGAGATCGATAGAATCCATTACACGCTC
CTCAGAAAGCTGAGTACCGCCGTGCTTAAGTAGCTGGTCAACCAATGTGGTCTTACCGTGATCGACATGCGCCACGATGGCCACGTTCCGAATGTTCTCA
GCCGTGACGGCCGAGTAGTCTGTAGAGAATGCATGCGCTATTACCGGCAAGATTCTCCTATGATGCGAGTGTTGGGGCGAGCAAATGCGCGCCGCCGATG
CAAGTCGGGAGCGTCGAAGCCACATTTATCCGACAATTTTGAATGGTGATGAAGATAATCAAAATCTGATTAACCGCATAAAATGTTAGAGGTACACTGC
CAGACAACATTCTCTCACCTACTGCACTGTAGCAATGTCAATCAATCGTTCGATTCCCTAATATACAGGTGCTGGTTGAaagaatgatttttttacagCA
GCATAAAACAACAAAACAGAGCACAACAAGCAAAAGTAGCAGTGGTGTCGCAATTCCACACTTGAGGAGGTGAGTATTGAAACCCTCCCACATTTAGTAA
AATTGTATCAAACCAACAATACGAGATTTACATTGTAATTCATAAGAACCAAAGTATGGGTATTTATCAGGGATGGCAAATAATTTGGGTTTACGTTGTT
TTGTTTCTTCTCTTCCATTGTAACCGGGTTACATTTACCTTGGTATCAAGGATAGGTGGCACAATATACAAagatgtgggttacacaaaacGGTGAGAGA
TAAAATAGTTTTTTTTTCGGTTTTGCTAACGTTTTTTTCTGTTCCCGCCAAACTTCGATCTATAGTAGTAATTGCTCTTTGGACTTTTTGGCCTTTAAAC
TCATcttaatcacacaatggtgtggccacatcTTGACAATAATCTTTACAAACAAAATCATGGCGTGGTATGGATCGTGAATATATCAGCCTTCATATCA
CCGACCGTCAAAACAAAGCAGCCGTTAATATACCCGAAAGCTTTGTGCTTGAAATGGTTTGCGGGCTTAAAATTATTAACATAGTCCACATCACTCACAA
TCTGTCGACAAAATTagctcatgtcacgcataAAATGGCCAGGAGAGCCCAAACGTGAGCGTTGCGTGGAAAGCAAATTGAACCGTCCCCCACTGCTCTC
AGGACCCCGCATCAGCTCTGCAAGATCAACACGAATTAGCATCCATAGACATCCAAAAGAGCACCAGAACAGCCATTCTATGACTTCGTTGATGCTTCGG
TCTTTGCCATAGGCACACTTTACTCCAAGCTAATAACGATTTGCATGAACGCGTTATCACGTCAAAATCTCGTCCGCTTAAAGCGGATGATATAAACTTA
GCTGATCATGACAAAGAACTACTGGCAACATATTGCACTTAAGATGCACTTGATTGGTTATAAGCAGTTTGCAATCTATAGACGTCTTGCGTCGTTGTTT
atagtgacgtcgtcactaCTTGTCTCACATAAAAGGGCTAGATAGGTATCATTATTTGCTGAGTATACGGTATAAGTAGGGACTTCTTAATATAGTGGCG
GGTGCGTTTTGACGACACCCCAAATATGAGCCGTCCCATAtcgcgatggtgacgtcgccgactGATAATGCAATTCGTCCGGCACGCGGGTCAGACGCAG
TATGTGTTGTGCTA