Description :
From Genome Similarity Track
Location :
Scaffold_1225:2180- 4011
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_1225-abinit-gene-0.6Reverse transcriptase

Sequence
1831 bases(100 bases per row)
CCTAAAGCGTATTCGGTTCCAGTACGAGTACCGACAGGTATTCTGGTTGCTCACACACTGGCTGTACATAGCCCGAACTCCGAATGCTGAGCAGTCACGC
GCGTGGTCGAACCTGTACGCGAACCGGGAGGGACTCNNNNNNNNNNNNNNNNNNNNNNNAAGAAAGTGCTCCGGGCCAAGTCTGCGCAGATCGACTCAGA
AGCGCCACCAGGAACCTGTACTGCGCTACTTCAAAGCGAGCCAGCGCTGTGGGTTGAGCCGAGAAAGCCGTGCCCATGGGCACTGGAGGAGTTCGACGAG
GGTTCATCGGCGATTGAGCAAGTCCAGGCGCTGGACGACCTTGAACCTATCCGGTGCTACTGGGCTGGACACCATGGTCGCTTCGTCGAAGCCCTGTTGC
CCGACCAGCTCGAGATCATGGACGGGCACGGCGGCCAGTGCTGGGAACTGCCAACCCCGTGGAACGACCCCAAGTACACGCCGATCCCACTCGATCAAGT
CACACCCGGCACCCCAGGTCCCGAATACCTGTTCCAAGACCCGAGAACGACATTACAGTCGACGCCCCTGGCCGAGTAGTCCTCGTCTGGAGCGTTTGTC
TTCTTCACCGCGCACCACTTCATGTCTTCGATCCGGCTCGGTCTTCCGAAAACTGGTTCAGCATCTCTTAACCTCTTCAATATACGTCACTTGAACATGG
ATGGGCTCTCTTGTGGTCAATGAGCATTGCTGAACAGGACTTGCGTCGACTGCTCTGTTACGCCCACTCGCACGACTCAGGAGCTGGAGCCGTGCACACG
TCTGACGCTGATCGACGCGCACCTTCATTTCATCTTGGGTTCCGATCAGCAGGAACCCGGATGGCTGACTTTTTCGCAGGGTCAGCCGGTCCTGCTTGGC
GTGGAAAGCCGAGCAACGCCCCTAGGCGTCGGCGGCCACAGCTTCACTCGATTCGTCGCCAGTCTGCATCGCGGCGAACCGGCTTCGTGCTCGTTGACTT
GCTTCAAACTCGTACAGCAGGCGTCCCGCGTTCATTCGATCGACTGGAACCCATTCCGGTTCTGCATAGCCAGTCCAGCGAACAAGGTACTCGCGCGTTC
GACGCCCATTGCGTGTTCGAGGGGATGTCCACTTCACATCGAGAATCTCGTCGATCCGGTATTGGCTAGCCGCATGATCCGGTTCCCAGCTGTCTTCCGG
TAGAATCGCGGCGTCGAGATCGTCGTCGTCGGGCACATTCACTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGACCAAGCTGGTCTCGTCTC
ATGGATAACTCGTGGCTTCAGCCTGCTAACGTGTACCCATGGTGCGATCCGGTACGGGGTGCCGGCGACGTCGAGACGGACACGAAAAGCTTCGTCTTTC
TCGGCTATGCGGAAAGGGCCATGCCAGGCGTGCGCCAACTTCTTGCTCCGACCGGGCTTAACACGTGCCATGTAGAGCCAGACCTGTTGACCGACCTCGA
AACCTGCCTCGAACTTGTCTGGTAACTGGTTCCACGACTCTGTCACAGCGGCGGCACGGGCTTCTTTCGCTTGTTCTTGAAGATCACGTGCCCATGCCTT
CGCGTACTCATGATGCGTGCGGTGAACTCGCAGCCTCCACAGATAGGCGCTCAATTCATCGCGTCTGCGCGGAGGCCGCTCGAGCATAGCAGAGACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTGCGTGCGTCCCATCCGTGTAACAAGAAGAAAGGCGTGTCCTTGCGCACGGTGTCGTAAGACGTGTTGAT
CGCAAACATCAACCGGTTCACGACGTCTTCC