Description :
From Genome Similarity Track
Location :
Scaffold_561:2180- 3941
Transcript NameFunction/comments
Phyke_g10430DNA replication licensing factor MCM7

Sequence
1761 bases(100 bases per row)
CATGCAACTGCTGAGTTGTGAACCCTTTGCGCAACACGACCGGTTCCAGGTCGCTCATAGGGAGAACCTTCAGACCACGATCCGTAGCAAACTCCAACAG
CAGACGGTAGATCCTGGAAGTGGCGTCAGTAGATCTACCGCGACCACGATTACCTGTGCCAGCCTTCCCACTGTTACCACCTCCATTGGCATCGTCCTGT
TCAGTCAACGACGCCTTTGACACGTACACTAGTCGGATCGCTTCGTCGACGTCTTGGTGGATGACTTCCGTCGAGAACCGCAGGCGTGCGAGTGCCTGCG
ATAGACGAAGAATACTCAGCAATTGACGGGCTGTCATGGCTGTCTGCGCATCGTTGGCGCCGCCATCGCCATACTGTTTCTGTCggaattgctgttgttg
tcgctcacGTGCATGTTCATTGGCATCTTGCTGGCGTAGTGTGACGTACGCCTCGACAATATAACCGCACAGGTGTTCGGGGATATTGGGCTGATATTGC
TTGGCAATAGCGATAAAATACCGCAAGACTTCTGGACGCACAGGCTCGAACTTCATATCCGGGTTGCGCGAGAAGCGGTGCACATACGTCACGTGACGAG
CAAGCGCCTCATCCTTCTCGTAGTTGGCAAtatccagcaacaagaacaaaagGTCGAAACGCGACAATAGCGCGTTCGGCAGGTTAATATTCTGCGACGC
ACTAAGTTTCTTATTGTAGCGACCAAAGATGGGGTTTGCCGCTGCCAACACCGACGTGCGTGCATTGAGTGTGGTCGTGATACCTGCCTTGGCGATACTC
AccgtctgctgctccatcacctcGTGAATAGCTGTACGATCCCCTTCTTCCATCTTGTCAAACTCATCAATACAGCAGATCCCCATATCCGCCAGAACGA
GGGCACCTCCCTCCAGTGTCatctccttcgtcgtcgtatcacgcaccactgcagctgtcAATCCAACACCGGAACTACCTTTACCCGTGGTATACACCCC
ACGAGGAGCTACTGTTGCAATATGTTTCAATAACTGAGACTTTGCCACTCCAGGGTCTCCCATCAGCAACACATTGAGATCTCCACGCAATCTCATTCCT
TCGTCCATCCTCTTGGTCACGCCACCAATTAAAAGCAATAAAAGTGCTTTTTTCACATCTTCATGTCCGTAAATTTCAGGTGCCAAGGACTGGGACAAAA
CTTCGTAAACATTGGCCGAACCTTCCTGTAGACGTAATACGGCGCTCTCCATGGCCTCAGAAGATTCCATTGCAGAATACCGTTTTTTGTGGTTAACCAC
ATCGGTTGCCTCCAGATACGTTTCTGTCACCAGGCCCATTTGCATCTGACGTTGCGCCGAGTAAGGTAAAGGCAAAAATACGCCACAAATGGTGACTAAC
GCGCCCGGTTCACACGTTCGTGTGAGTTCACCACGTAGATAAACTGTGAGAGATCGGGGAATGTGCCCCATTGGCACTTGATCTGGCAATTCTTGGAATT
TCACTTCTTGGTATTTGTCAAACTTGGAAGCTTTTGTTTGCATCAGCAACCGCCCACGAGCGTTGTTGGTTTGGCAGCGTTCACTGGGACATTGTGTCAG
TGGATTAAACTGTCGTGCCTTAACCTCTTGGTACACTTCGTAAGCACAAGCTTCGCAAGTGTACGTTGCCACAGTTAGGAGTGGTTTAACCGTGGAAACA
CGAGTTACCATGCCCTTAATTCGGACAAGAGCCCCGACTTTGGCAGCTTTCACTTCTCGGA