Description :
From Genome Similarity Track
Location :
Scaffold_276:218- 7393
Sequence
7175 bases(100 bases per row)
AAGAAGAGCTTGACACCGACGACCTCGAGGCCGCTGGCTGCGCGGTTTGTGCCCTCGGCGCGCATCGTCCTCGCCTCCCCGTCGCGCCCCAAGTCCAGCT
TCCGGCTTCAGGCGCCCCCGTCCACTCGGTGACTGCTCTTGTCGCCGACGCGCACACTCTCCAGCGCGAGAACCAGGAGCTGCGCGCCCAGTACTAACTC
GTCTCAGCGCACAATGCGGGCTTGGCTACTCACGCGTCCGTGCTGCATGACCGCAATCTCGCGATCTTGCATCGTGCTCGCGAGGGTTATCGCGCAGGCA
TGATCCGGCTCGAGCAGGCGCTCCTCTCCCGGGAGCACGCCGAGCGGGACTACGCCGTCCTGGAGGACCGAGTGGCCGACTTCCGCGCTCGTGCTGAGCG
TGCCGACGCTGCCGAGGCTCTACTCCGCGCCGAGCGAGGCTCCTCGACAGAGCAATATCGTGATCTTCAAGCTCAGCTCCGGGCGGCACGAGACCAGGTC
ACTGACTTGACTGCCCAACTCGCGCGCGCTCCTGCTACGCCGCCTCCCTCCATCGTGTCGCTAGCGCAGCTGTTTGCTGCACAAGGCGAGCGCGACGACG
CGCGCGCCGAGCGTGACGACCTTCGCGTCGACCTCGCAGCCGCCCAAGCCGCCCTCGCTCCTGTCCAAGCGCGCGTGGCCGCCGCCGAAGCTGAACGAGA
TCACATGCGGCAGCTCGTGGCCACTGCCGAGCAGCAGCGCGACGCCGCTCTCGCTGAGCATGACCGCGTGACCCGCGTTCTCATGGCCGTCGAGCAAGAG
CGTGACGGGGCCCTCGACATGCGAGATCAAGTGCGTCGCGCCTCCACGGCCCTGAGACGCATGCGAGACGCTGCTGTCACCGAGAGGGACCGGGCACGCC
AAGCCGTGACCGCCCTTGAGCAGCGGCGAGACGCTGCCGTCGCCGAGAGAGATCAGGCTCGTCAGGCCTTGACCGCTCTGGAGCAGCAGCGCGCCCCTGT
CGACGAAGAGCTCCGCGCGGCCCGTGCGTCGCTTTCTCAGAGCCGCATGGAGATCGAGGCGGCCCAGTACCTAACGTCCCGCTGCAGGACGACCTTCGGC
GCGTCAACGCGCTCGTAGTGGCCCACGCCTAGGAGCTCCGCCGCGACGCGACGCGTATCCACGAGCTGGAGGAGTCCGTGGCTACTGCTACGACTCTCCG
TGTGGCCGCCGAGTCCGAGATGGCGCGGGCTCAAGCCGGCGAACTTTGCGCCACATCTCGCGCGGCGCAGTATCGAGCTGGGTGGCTGTCCATGCGGCGG
TCGTCTCAGCAGCGTCGAGGAGCAGTCGGCGCCCAGACCCATCGTCTCAGCGCTCGTGTCGCCGAGCTGGAGGAGGAGCGCGACTTGGCCATCCGAGAGC
GCGGCGAACGCGCTGTGACTTGGCGTCGGATGCTTCGAGACGCGCGTCGGGGCCGAGAGCTGGCGCGGCGGGTGTGCGACGAGCTTGCTGATCGTCTCGC
CGGCGTCGTAACGCATGTAGGCGGGCAGATCGACACCGCTGACCTGGTCAGGCGACTCGAAGCCACTTTTACGGCGGAGATCGACGGTGCGATCCCCCTC
CCCCCTGCTATTCCTACGTCCGCAGCAGTTCCTGTGGCATCCGCGGTTCCTGCTCCTGCTCCAACTGCGTCGAGCTCTGGTGCCCGGGCGGGCTCGTCGG
CTTTGACGGCGGGCTCGACGACTGGCGCTTCCCCTCCAGCAGGTCCTTGGGGCTCCCGTCCTGTTCCGACTTCGTCCGCTGCCTCGTCCTCGTCGGGTTT
TCGGCGACCTCGACACGGCGCGTCGAGTCGTTCGGGTTCTCAGTCACGCGCGTCTAGGCCGTCAGGAGTGGCGTCCGCTACGTCGCCTGGTTCTTCGCCC
CTTCGACGTAGTCGACGGCTCTCTACCGTGGCCGACACTGCGGCCTCCGACAACGCCGCTGCGCAGGCCTCATCTGCAGCTACGCCCTCTACGGCCGCTG
CAGCGCGCGCACGAGAGGACGCGTCGCTCTTCGGCTCCGAGTCTTCGGACAGCGAGGACCAAGCGCGGCGAGCTCAGTCCAAGCGCCGCCGGCTGCATAG
CCCTGGGTCTCGCTCACGGTCGCTGGCGCGTCCGCCTCCACGTTCGCAGTCACGTTCCCGGACACCCCGCGCTCCCGTTCTGCTTCGCGTTCGCGTTCCC
GCTCGGCCTCTCGTTCGCGTTCGCACTCGCCTCCACGCTCGCGCTCGCGTTCTCGCTCGCCCTCCTTGGCGTCGACGCGTTCCGTCGGCTCAACGCGTTC
GGCGCACGCGGCGGGGTCGGCGCACTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGGTATCCAGGCCTCCAGCACGCGACGTTGCAAGTCGCGCTCGACGACATCGACGCGCAGGAGCCCTGGCGCCGGTTCTATTGGACGCCGCTCAC
TGTGGCCGAGATGGACGCGAACGTACGCTGCCGAGTGACGCGCGATCACCCAGCCTTCCATGTGCCGCGTCTTGCAGGTAAGTTTGTCCAGCAGGTTTGA
GTCTTGGCCCATCGTTGCAGTCCGTCGCGTTTAGTTGTTGTAGCCGTAACTTCAACACGTAGCCTTGATCTTTCCCCTTGTTTCTTTCCACTTCTCCACA
TCTTTTATGAGACGGCCCTCCGCCGTCCCATCTTCAGCAACAGGCTGGTCCTCCTCACTTCCCTCATCCAATCCCTCGCTCCGGCCATTCCCAGAGTCGA
GGCTTCCCACCAGTCCTCCCGTCGGCAGCCCCCCCCCCCGCCGACTTAGTCGCACCCGCGGGCGCTCACCCACCAGGCTCCACCGCCTCCGCGTTCTCGT
GCGACTGCATCGCCTCGAACCGGTTGCGTCCCGTGCGCTGGCGCAGGAAGTCGTACAGCAACCCGCCGCAATTCAGATCGAGCTCGTCGACCCACGTCGT
GTCCGGGTAGCCTTTCCATTTGACTTCGAACTCGCGTCGCGTGCGCCCATACCGGGTAGTCCGCCCCTCGCGCACATTCACGATCTTCTCGACCTCGAAG
ACGTCGTCCTCCAGCTCGCGCGTGGCTTCCCAGCTATCCTCGGGCAAGAGCTCCTCGTCGAAGTCGAAGCGCTCCTCGGCCGGCACCGTCAGCTGCGTCG
CGGGTCGCGACGGGAATTCCCGGACGGGCTTCAGCTTGGAGATGTGGACGACGGGGTACAGCTGATAGGGCGTACCCGTCGTCTCGAGGCGCACTGCGAA
CGCGCTGACCACCTCGGTGACGCGGAAGGGTCCGTGCCACATGTGCGCGAGTTTGCGCGCATACCCCGGCTTCACCCGATCCAGGTACAGCCAAACTTGC
GAGCCCGTCGCGATCTCATGTCGCGTCGCGTTTTCAGTTTGTCGACGCGCTCTCTCTTCGACGGCCTCTCGGACTAACTCCAACGCTTGTGCCCTTGCCA
CCTTGTAGTGTCGCTGAATACGGAGCCTCCACCGCCGCGCCTCGGCGTCCCGGGTCGACGTGTTCCCGACGGCCAGCGTCGACCGAGGATCCCAGTCGTG
CACTAAGAAGAACGGGGTTTCATTCCTCGTCCGGTCGTACGACGTGTTTAGTGCGAAGGTAAGACGCTCGGCGTATTCGTCCCAGTCGCGTTGGTCGACG
TCTGCGATGTACATCTTGATCGCTCTTGTAACCGTCTGCACCATCCGTTCTGCAGCACCGTTGGCTTGGGGACGATAAGCAAGCGTCGCTCGCTGTCTCT
GACCCATGATTTTGCTGAACGCTTTGAAGAAGTCGGACATGAAGCCCGGCTCGCGGTCGTGGCGGATAGCCGGGCTCGTGCCGAAGCGCCTGAACACCGC
CTCCTCGTACGCCTCGGCCACCGTCTGCGCGGTTCGTGACGCATTCGCTTTGACCACGACGAACCCCGTGAAGAGGTCGACCCAGACTAACAGCTCTGTG
TTGCCTTTGTAGGATGCCGGCAACGACGGAATATGGTCCATGGCAATGACCTGGAACGGGTACGTCGTGACGATGTTGCCCGGCGACTCGCCCTGGATGG
TCGGCCGACCCTTTCCCGTCTCGCAGTCGGTGCATTCGCCGACGTAGCGCTGGACGCTTCTGAAAATCCCTGGTCAATGGAAGTGGCGCCTCACGCGTTG
GTACGTGCGGCCAATACCCTGGTGTCCGCCTCCAGGCTCGCGTGATAGTGGTGGAGTACATCTTCCCGAAGAGTCTCCGGGATCAGCTTCATCATCACAT
CGCGATCCTCGGCGGAATCGTCGCTTCTCGGCTGGTAGTAGAGCAGCCCGCCTTCGCCCTCTTCGTACCGAGGCGCAAGCTTTTGGCAGTTCTTCACCTC
GCGCCGAGATAGGTCCCCGACGTCGCCGCGGAGATACTTCTTGAGGTTGACGATCCAGACCTCTTCGTCCTGGGCGACGCGGATGCGGTCCAGGCGCATT
CGTTGCACCACCAGCTCCTCCAGGACTTCTGGAGGTCGGACCCTACGTGTTGTCGTGCGTGCGGCAGCCGAGCGCGTCGTCACAGCGAGGACTTGTGCTG
TCCCGCGTCCCGCGTCCATGGCCTTCCCGGCGGGGTCATCTGCGCCGCGATTTTCCGCGTCGAGGTTTTCCGCGTCAAGATTATCCGCGTCGGGACTGGC
TGGAGACGCCATCCCGGGACTCGATGTCCGCGGTCGGATGACTTCTTCCAAGCGATTCAGCGTCTTCAGATCTTGAATCTCTTCGGGGCTGTGCGCGTTG
CGGCCTCCTTGACGCTGCAGAGCTTGTCCAGCCAGCATGTCGGCACTCGCGTTCCAGTCTCGTCGTACGTGGAAGAGTTCGTGGCGCGGCCATGCCTGGA
GTGCGTTTCGCGTCTTTTGTCGCAGCAGCTTCAGCCCCGGGGACTTGCAGTCCATCTCGTCCGGCATCTGCCTGATGACAAGGTTAGAGTCTCCGCATAC
GACGAGTCGGGTGACGTCGTCGAGTTCCTCTAGAAGAGAACATCCGAGCAGCCGCCCGCGGTATTCCGCCTCGTTGACCGTGAGGTCCGTCGCATATCCC
GACGCGGCGCGCACGCTGGCGTACACGATCACGACGGATTCTCGGTTCGCGTCGAAGTGTTTCAACATTGGGGTCTCGGCGAGTTTTGCCTTGAGCGCGT
CGAAGGCGCGCGTCGCGTGCATCCACTTCTCATGCCCGCGGACTTCTGGACGCGTGACGTACTCGTTGAAGTCGGTCTCCGTCAGCGAATACACCGTCGA
GTTTTGGGTCAGCGAGTTCCGACTCCGGCGATTCTTCCATCGCAGCGCTTCTAGCCACAGTCGGAGGCATATCGGGTTCGCTTTCCACCGCCTCCTCGTC
CGTATCCGGCTTGTGGTCGTCGGGTGGCAAGTCTACCCCCCTTCCCTTCGGCGCTTCCGCGACAGCCGCCAACACTGGGGTCACGGCGCGTCGCGTCCCG
AGTTGTCTCGGCTCCGGGCGCAAGATGGCTTTAGGCGTCGGGTATGAGGGGCGATCCGTCATCGGTCCGTCGAGCTCGGCTGGGATCCAGTTCTCCTCCG
CGTCGCGTGTCGCGCCGTACGCCAGATTCTGCCACTGCTGGTACCGGGTGGAGCCCAGTCGGACGAATCCACGAATCCGAGGCTGGCCGTCAGACGGCGT
CCACCACCCAAGCGTTTCATGCGCGTCGAGGATTATCGCTGCGTCTCCGATGTTCGTGACACGCAGGTACGTTTTATTTCCGACTCTCCCCTTGACAAAG
GTAGTCACCCACGACTCTGCCCGTGTCACCCACAGGAACGGTGCGTTTCGATCCGGCCTCAGCAAGACTTCATGCGTGTCTCCTGGTTCGAGCCTCACAG
GCGTCTTGACGTTGACCGGGTCCATCCGTGCGCCGTATAGCGGTCTTCGTCCGATCATCTGGCTATGCACCTCGTCGGGAAGGCACGTCGTGCCGTCCGC
AGTGTCGATACGCACTCCAGCGGGCACCATGAAGTTCATTCCCAGGATTGCGTGTTGGCCGACCAAGTCGCCGACCACAGGTGCATGTAGTACACCAAGT
TCCCAGCCAAGGTAATCTTGACTCTGGTTCTCCCCACCGTGTAATATGTCTCATCACGAATTCCCACACACTCTTGCGTGATCTTCGTGTCAATCAGGCA
GCCTACCTCACGAGCAAAGGTGGTGTCCAGGATGGACACCTCGGCACCTGTGTCGAGCAATAACACAGCACGGCGGTTGTTCAGCTTTCCATGAATCTTG
GCCTGCTTGTACCACTTGTGCGGCGCGTAATGTTTCCAGTATCCGCGTCGCTCTCCTGGTTGCAAGTCGATCTCGTCCAGGGGTGGTTCACGTGCAAACT
CGTCGTCCGTCGTACGTCGGACCGCCGAGATTCGCGGCGCGCATTCTTGTGTGGTACGTTCCGGGTTGGATTCACATGTATTATCATTCAGGGAAGTCGG
GCTCTCACTAACCACCTCTCGCGACTTCTTGGTCACATATGCATAGACGGAAACATGTCGCTCGTCTCGTACTGG