Description :
From Genome Similarity Track
Location :
Scaffold_1922:218- 1362
Sequence
1144 bases(100 bases per row)
GCACGCCAGACGCCAGCTCTGCGGATGCCACCTTGGCGTGCAAGAGAAGCGCCGTCGTGGCGCGCACACGCAACGTCATGTTGTCGAGCATTTGCGCAGC
GGGCACTTGGCAGAGAGCAGTCACAAGCCAGGCGCTATCGTGGCGAGCATCATATCTTTGAGCACCGCTATGGTCATAATGTAAGTGCCACAATCTAAAC
AGTATTCATTTAGATCAACCAGGTAGCTTCTTTAAAACAAGTACATTCATTTCACAGACCAGAGGCCGACGCGAATGGCTAAGTCTGACACGCTGCCATC
CTCATCGTCGCTCTCGACGCCTGATTCGTCGTTGCGAAGGGGTAGAATGAGTCCGGTGTGCTGCCAGCAATGGCGGAGCGTCGCCGGGCTTGTCTCGCTC
CAGATTTCCCGACTCCAGTCCATGGCTGTCAATTGGTTAAGTTTGTATGCTTTGGCACCTTCAACGTCCTCACCGCTGTCGATCCGTTTGATTGCCTGGG
CAATTTGGCGCGACCGGTAGCGAGCCTTGAACGAGGCGATCACGCCAGCATCCATAGGCTGGAGACAAGAAGTTGTGTTAGGAGGGAGCATTTTCACAGT
GACGTTGGTTAAATGTAGATCACCGCAGGAGTGTGGCGAAGCATTGTCGAGTAGTAACAGAACATCGCGCTCTTGAGCGCGCATCTTGGCGTCCAATTCG
CGTAGCCAACGCTGAAACAGTGCCGTCGTCATCCACGCCTTCTTGTTGCTCTGGTAGGAGTGGCCAAGCTCATCGGCGGTTTTTTTGCCAAAGCACCGTG
GGCGGGCAGCACGGCCGATAAACAGAAGAGGCAGTAATTCTGACCCGTCAGCATTCGCGCAGAAAGTGATTGAAATTCGCGTCTTGTCCGGTTTCACACC
AGGCTTGCCCTCAGTGCAAATATCACCGGCAGGGGCTTGAGAGAAACACAGCCCGCATTCGTCCATATTGAGGACATCGCCGAAGTTGTACAGATCGATG
ATGTCCAGCAGCTTGCGCCGACCTTCTCGAACAACATTATGGTCAACAGACCCTGCTTCTCCGTGCTTCAGTCGGAAGCGCAAACCGTGACGGCGCATGA
ACGCGGAGAGCCATCCAACCGATAGGCCCATGGTGAGGGCCGCT