Description :
From Genome Similarity Track
Location :
Scaffold_275:21797- 25963
Sequence
4166 bases(100 bases per row)
ACGCTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTGATCAATGATGGGGCACCGAATCGTCGGTACACACATTCTTCGAACACTTGAGC
AACACTCAGTGCCGTTGTATCTGACATAGCCTTGACAATAACGAATCCTGTGAACGAGCACCGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTC
GGTAGTGGGATCACAAAGTCCATCGAGACGATATGAAACGGTCGTTCGGCTAGTACGTTGCCAGGCGAGTATCCACGAAGCTACGGACTGCATATACTCG
AGCTGCAATCCGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGATCCAGTAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACC
TTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATCATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCCAACCG
TGGTCGTACCGACGATTCAATCCAAGACAGTGAAGCACGCCGTCTTCTGATAACACGAACCGGTCAGCATACTTCCAGGCATCTCGAGCTTCTTTGTAAC
ATAGCTCTTGTGCTTGGCCCTGAAGCACCTTCTTGATGTTAAACCACTTCTGTTCCTCGTCTTGTGCCACTAGTATCCGTCTGCGTCGCTCCCGCTGTAT
CGCTACCGGGTCAACATCTTCCGCATCGGGAAATGCCGCTGGCACAGTCTTGTGAGGATGGTCTGACAAATCTTCGCCGATTGAATCTTCGTTGGACGAC
TATCGTCGTTTTCTTGAGCTTTTGAGACTTCCTCCGAGTGTTCACCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCTAGTCATCACTGCAAT
ATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCACAAAATTTTCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGC
TCTGCTCCTTGTGACGAAACATCTACCAAAAAAAACCTATCGAAAGTTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTC
CTTGTGACGAAACATCTACCAAGTCTTCATCCGGCTCGTAGATCATTTCCTGGATGCGGTTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGAT
TACCCGACTGACCTTTGATTCCAGCGCTTCAGTGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTG
GCCGTGAGTTACTTGTGAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTTATTGATGAATCGCGAGCCTTGAGTCACCAA
CGATGACTAAATCCTCGGCACTGAGCGCAATAGCAGCCTTGACACCGTTAATTATTCCTGTATACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGC
GTTTGCAGCAATCACTATCTTCCACTCAGTAAGGCTCCACAACATCCATGATCAACTCCCGTATCCACCGTACCTCTCTGTCTTCGCTGATCCGTCAAAA
GACATGACGAATCCGCTGTAATTACGGGAAAGCCTGGCGTACAGCAACGCGGGGTTCATCCGAATAGTCGGGGAACCCTTGTTTGGAGGCGCCACCGGCG
CGAGTGAATCTTCCAAGTCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGTGCAAAGGCGACATCCTTCTCCTTCACGCGCTGCACTTTAAGGTGCCA
CTGCGATAGCAGCACTGCGAACTGGACCGCGCGTCCGAAGAGAGACTTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTC
TTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCC
GACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGATCAACACCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTT
CGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTCTCCAATTTTTTGAAGGAACGACGCGCCTAAGAAAGGCCACCTTCGACGGCAAAG
TCTTCATCCTTGAGCTGGTACAGGGCCGCCCCGTAGACCGCGAAGTCTTGAATGAAGCGACTGTAGTAATTAACCGCTCCAAGGAACGACTGGATGCCCC
GCTTGCTCGTTGGAAACGAATGCTCGGTGATAGCCGCAAGCTTCTTGGGGTCAGCCCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTT
GGGCTGGAAGAAGATCCTCTTGATGAAACTAATACTGATCCGACATTGTGCAAATCTCTCCAGCAATCGGTTCAGTGTCGCCAGACAGCTGTCGAAATCC
TCACCACCAAAGCAAATATCATCCACAAACGATCGTCGACCAAACACGGGTACCAGCGATGATTCGTCTGGCTCCCCGTTCGTAAACACGTCAGCGACAG
GACTGTTGATGAGTTCTAATACAGGGTCGGCCTCCACCGGTGCCTCGCGGTCTGCCGCGAACTTCGTTTGAAACGAACCCTCGGTTATTGCTCCACGACG
TTCCTTGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGCTGAACGAACCCCCAGAGTGCGTTGTCAATCATACGC
TGATAGATCATCGGCGCGTTCTTTAGCCCGAAGGGCATGCGTAACCACTCGAAATGTCCGAGTGCGCAGACGAACGCCGATACTTTACGCGCTCGCAAGG
TCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAACCATAGGTAGCGCTCGAGATCGGTCAACAGATCGTCGACTAGCGGCATTGCATA
TTCCATGATTGCGATGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGTCCGTTCTTTTTCATCACGACTGGCGATGCCCATGGACTG
TCTGAAAAGACGATCAGTCCTGCTCGCAGCAAAGCGCGCAGCAGCTCGTACAGTTTGCCGATAAAAAAATTGTAGCGGCACGCGCCGGGCACGCTGTTTA
ATTGGGGCGTGCCCCTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGGTGGCGGCAGTGCGTTGCCACTAGCATCAGGATGTGCTCGTGGTTCTTCAG
CGTCGCGACCAGACGTTCCCTGCGATCGGTCGACAGCTGGGGGCAGCAACATTGGGTGCATTGTAGCCTATAGTCGTGTTAATTTCTTCGGTCAGGTCCG
ACAGGAATGCCAGCTCCTTTGCGTAGTCTTGCAAGCCAATGTTGTTAGCTGGGTGTTCGTAGAAGTCATTCCTTGCGTTCTTCGCTACTTCATTTCCTTC
GGTTGCTAATACTCGTGCGACCGAGATGTACGTCTCGTCCAAAGTCGCTACGGACCCTTCTCTTGACTCAAAAGCGACATCCTCCTTGAGTTCAACATTC
GGTACTGGGTCCATCTCCTTCCCATCCTGGTTTCCCATCTCTGGGCCATCTGCCGAGTCTTTGTTCGCAATGTTGAATGTGCAGGCAACCGACATGTTGG
GCTGTTGACTTCTGTTCAGCGCCTCGGATGGCCGTTGTCTTGACAGTTCGGCATTCGCACCACTCTTGCAGCGAACACTCGGTGCCGTATTCACCACCTT
CAGCGTGATGTCTACATCCTCTGGACCAACCACCGATGACTAGTTCGCAGATTTGGTAGCACACAAGGCCGGGACAACTTCGTCAAAACTGGTGACTCCA
TTTAGTCTATTGCCGTTATTTGTCGCTTCCGTGATCACCCCAGACTTGACACGAACACCCGTTGGCGTATGTACAACGTTTACCGGGCTCAGTAGCTCGT
GTGTACGCGCTACCAAGGCTTCGTTTGCAATATTGCCCCCGCCGTGAGCTGTCGTGTAAGTGTCTGAAGGTTCTTCGGACGGCTGACCGTCGGCCGAATC
CCCGGCTGTCACCCCAGACGCCAGACAGGCTTCCACTCGTTCACGTTTCTCCATGATCATTGCCCA