Description :
From Genome Similarity Track
Location :
Scaffold_297:21797- 24285
Sequence
2488 bases(100 bases per row)
TCCGGACGGCCGCTGTTATGTTGAGACTGCGAACTTAGATGGTGAGACGAACCTCAAGATCCGAAGCGTGGCGAAGCCTACCAAACACTTTCTGACTGCG
GATGATATCCTGGACAAGTACAAGCTCCATGTCGAGTGCGACGCGCCGAACAAAGACTTGTTCTACTTCGACGGTGTGCTGAAGCTGATCAACATCAACG
CGCAGACTGAGAACGCTGACGGTTCGACAGAGATGGCGAGTCTTGTGGATGACACGAGTCTCACTATGGACAACTTGATTCTGCGAGGAAGTGAAAGCCG
CAATGCTGAGTGGACGATCGCGTTTGTGATTTACACTGGCAAAGAGACAAAGATTGCCATGAACTCGTCGGACGTGCCGCTCAAGCGAAGCTTTGTTGAA
AAGACGCTGGACACGATGTTTGTGCTGGTGCTGGTCTTGCTTTTCGGTATCTCTGTGGCGTGTACGCTTGGCAACAACGACTGGGGTTGGGATCTGGATG
ACACGAACGCTCCGTGGTACATCGGCAAGTCGACCGAGAATGGGTACATCTTCCTGAGTTACGTGATCCTGTTCAACAACCTGATCCCGCTGTCGATGTA
CGTGACGATGGAAGGTGTGCGTTTCGTACACGCCAGGTACATTGAGAACGATCTGGAAATGTACGATCCACACACGGACACTCCGGCGCAGGTCCGCAAC
AGTAACATCAACGAGGACCTGGGTCAAATCCAGTACATTTTCTCGGACAAGACTGGCACGCTGACGCGCAATGAGATGGTGTTTGCCAAGTGCACGATCG
CGGGACTTCGCTACAATGACGTTGAGATGGATTCGGGAAAAACCACTCGCCCCGGCACTCGGTTCAACGACTCTCGACTGATCGGTCGCTGGAATGCGAA
CCACTCGACGAAGAAAGAGATCACGGATTTTCTGCTCTTGCTGACGATCTGCAACACTGTGATTCCAGAGTACGAGGCTCCTCAGACATCCGAAGATGGC
AGCGGTCTTTCAAGACCTCTCGGGAAGATCAAGTACAACGCTGCGTCTCCCGATGAGCAGGCGCTTGTGCTCGCCGCCAGTGACCTCGGCTTTGTGTTGA
CGGGCCGTGACGGTCCGATCTGCGAGACGATGATTCAGGGCGTGCCAATGTCTTTCGAGATCTTGAATGTGCTCGAGTTCAACAGCGACCGCAAGCGCAT
GTCGATCATCTTCCGCCACCCAGATGGGAGCATCATCTTGTACTGCAAAGGAGCCGATGATGTGCTTTTCGATCTACTGTCAAAATCTCAGCCACAAGGT
GTCGCGCACGTCACGCGAGGCCACTTGCAAGAGTACGCGTCCGAGGGGCTGCGCACATTGACGACTGCGATGCGCCGTCTGTCGACTGAGGAGTACGAGC
AGTGGAACGCGCTGTATCGTCAGGCAGAGCTTTCGCTCGACAACCGCGCGGCGAAGATCGCGAAGGTCGCTGCTGTGATTGAAGTCGAGTTGACTCTCTT
GGGGGCGACGGCGATCGAAGACCGACTGCAGGAAGGTGTGGAGGAGTGTATCACGTCGCTTCGCAAGGCAGGGATCAACTTTTGGGTGCTGACCGGCGAC
AAGAAGGAGACTGCGCTCAGCATCGGCATGTCGTCGCATGTCATTGACGACAACATGGATGTAATTGTGCTGGGCCAGCGAGACAAGGCGTCACTCCGAG
CCAAGCTGGAAGAGCTCTACGTCGACTTGGTCGATGACAAGTGGGGCTCAGACGAGCACTCGTCTGCTGTGAGCGTGCTGTACGAGGCGTTCAAGCGTGT
GTTCATGATGGGCTGGGATTTCGCGAAGACGGTGATCTTTGGCCGTGACGAGCAAGCGGAAGCCCGCAAGAAGCGCAGACGCCAGCCACGTCGAGAGCAC
GAAGAGGTCGACAACACGCCGTCCAACAGCCAGATCCAGTTCGACGAAGTGTACCCTGCGTTGAACTCTGACAACGGGTCTGACACGGGAATGGAGTATG
GCCACGGCGACCGCCAGTTTGAACCGAAGAGCGATCTGCAGGACGTGAGCGAGGAGTTTGTGGACGAAGAGCTGGAGTTCGCGATGGTCATCGACGGGAA
GACGCTGGCGCTGCTACTCGAAGACGACATCAAGTACCTGTTCCTGTCCGTGGCGACGCAGTGCAAGTCTGTGATCTGCTGCCGCTGCTCGCCTGCGCAG
AAGGCGTCGGTCGTGAAGCTCGTGACGGAGCCGACGTTGATGTTTTCGCCGGGCAACATCACGCTGGCGATTGGCGACGGCGCGAATGACGTGCCAATGA
TCCAAGCGGCGAATGTCGGTGTGGGCATCAGCGGCAAAGAAGGACGTCAAGCCGTGCTCTCGAGCGACTACTCGTTTGCGGAGTTCCGATTCTTGAAGCG
TCTGCTTTTGGTGCACGGCAACTACAGCTACAAGCGCATCTCGAAGCTGATCCTGTTCTCGTTCATGAAGAACGTGGCACTGTCGCTC