Description :
From Genome Similarity Track
Location :
Scaffold_44:21793- 23271
Transcript NameFunction/comments
Pytap_DAOMBR444fgenesh_masked-pag1_scaffold_44-abinit-gene-0.118GK15089

Sequence
1478 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGC
CAAGAAGTCCATAGTCTCATCATAGCCAGCGAGtGTTtGATGCCGGCCGTTGAACGGATCTTTCGGTGCAGCGATGATCGGAGCAGCCGTGCGAACcTCC
TCTGTGGCCTTGGGGATGACCGGGACTGCTTGGGGATGATCCGTCGGCATCTTtGCaTCCTGCAGCGGgTCTTCAACCCGTGTTACCACAATCGCAGGTC
CCACATGCTCTGTTGGCACAGGCGCTGCATCATGGGTCTTCTCATCCGCCTTGACGCTGTCAGCGACCACAACGCGATCCTTCGCAGCGACTACAGGGGC
AGGCTTCTTGGTGATCGCTCCCGCCTGCACAACGTCTGCTGGTGGTGCGCCCGGTTTCctCGTCGCCACTGGGCGTGTTGGCATAGCTGCTTGAGCCAAC
ACAGGAGCGGGGGCTTGTGTCGCCTCTGCCATCTCTCTCGTCAGATGCCCTTTAGGGATGTCTTCGCCACCAATGGCGTTCGCTGAGGAGACCGTTGAGC
TCGCGTAGAACTGCACTTTGACCACGAAAAGCACGTAGAGCATGAAGAGGgCGGCAAACGCCTGCACCCAGACGCTGGAGAGCGGCGAGCGCTTGCGCCG
ATCGTGGCGATGGCGCTCCATGTTCCTCTGGTGACGGTCTCAGTATGATGAGGTGGCGCCGTCTCCAGCAAGaCGTACCACACTGGCTCGACTCAGATGT
CTGAGTCTGAGGACgTAACaGGAACTCACAACCGGATACATTTTCTCAGGATAGAATTCAACGTTTCTAACGTTGCTACTAGCATGATAGCCTCTAACAA
GCACACCGAGATGGACACGAGTTCACCACGGCTTATCGCTGAAGAAGTTGATGATCTTCTGCTTCTCACAAAaGTCCGCTGTGTACTCCTTCAGCACAAC
CTTGTTGGTGGCTTCGTCTTTGGTGACGCGCCCGAGGTACGGCACGCCTCGCAGCGTCACGACCTTCTCACGGAACTCGGGCAACTTGAACGGGTTTTtC
TTCTTCTTCCACATCTTGTACGAGTGAGACACAATTGCACGCACGAGCACGGCATTGTCAGGCGCGGAGTAGTTGTAGTAGTGCATGATAGCTATGTCGG
CACGGTCGCAAAATGGGCACCAAAGGCGCCCGTTGAATGAATGGTACCCTGACACGAAGAAGATGAAGAGTGGGTACGAGTTGTCATACCGAAGCaCGAA
GtCTTGCACAGATGCTGCACTGTCGAGCGTCACGACTTGGTTCTTGTTGGGCACACCGGCGGCTGGGTACGGCACACGGAAGAGGTATTCCAGCAGGTCG
TAATCGAGTGTGTACTGCTCGTTTAGCATGTGTGACGAGTTGCCGCCGCCATCGTACCGAAGAAGCGATGGGATGTAG