Description :
From Genome Similarity Track
Location :
Scaffold_281:21788- 23202
Transcript NameFunction/comments
Phyke_g7896hypothetical protein

Sequence
1414 bases(100 bases per row)
ACCGGTCTTGGTTGGGTCCGGTCGATTGACTCAATAGTTCTAGCTGATTGCACTTCTGACCCAGTAGCGCAAGTTTTGGGCGGTGTCCACCAGGTGCTTT
GTACAGCAGTAGATATACTTGCTATCCTGATGCTAACATTCCTGTGCCTTGAGGGCTGGTAAAGAAACTATCGTTATGTGCCTTTGATTTACGTGGCAGT
GACTGGCTTGTTCATCTGAGATGGCGTTTAAATTGTTGTGAACATCGGTAAGCTGACCTGGTAGAGGAATTGATTGCGAGGGGGACAAGAAGATCAGATC
GTCAACCAGGATTCGAGGTGATACGTAGTATTCACGAGCCGGTGAAGTGCGGCTAAAAACACAAAGACGTCGTGCTGCGATATTTATTTCCGGTCAAGTA
TTGCATTGCTCAGATGCCATCGACAAATCGGGTGTAGCACGCTAGTACTTGCGCCCCGATGAAGGAAAACGTTGAAGCAGAGAGTCGGTCATAGCAATCA
CTAACAAGCTCAGACAGCATTCGAGACCTCCGCAAACGAAAATTGGGGCACCCACTACACTAGTATCCGTATACAACAAGTTGCGTAATGCATGGCCATC
CCCTCGCGACGTTGCCATGCCCACTTTAATATTGAGACGCAGGATTCGATGCAGACACTTGTAAAATTCATCTCGTGAGGACGGTGAGTTTGGTGGGTTA
TGAACTAACCTAAGGATATGTATGCCTTTCACCACTGAGGCTTACGGCTGTCGTATATCGAAGCAGTTAAGAAAGGTGCTGGTCCACAACGGGGATTTCA
AACTTATTTCATTGCAGCTCGCTTAGTCGCGCGTCAACGATCTTAAGTTCATCTCGCAATGCTAACAACCGATTCTTGGTGAGCTCCGACTTGTGTGATT
TGGTGCTCTGTATTGCACCGAAATTTAACACGAGTTGTGCACTCTCTGCCTGGATGTCCAGACAGAGCTGTCTGCGTCGCTCTTGCAACTCTGCAATTCC
TAGTCCAGCAAGCTCAGGAAACTTGGAGGTTTGACCTCCATCTTCGTTTGCAGGTGTTGGATCGGTGGTTCTTGCATTGGATTCCGCAGCAAAAAAACCC
GGTACTTCTTCGGGTATTATCACAGCCTCACTTGACTTTATGACCTCGTTTTGAGCTGGAAAAAGCTCTCTGGCTAATGGAAGCTCCACTAACAATGAAG
TAGCTGGGTTGTGCTCTGTTTTCTTCAGCTCGTGACGGAATCGCTTGAAAGCTTCAAGAAAAGAAGCGCCATTCAACTCACTGCTGGCAATACTGGATCC
ACCATCGAGGAagctcaagacgctgtcTGCCTCTTCACCTCGCTCTTCATgttcgtcatcgtcttcatcaattGAAGGGTTATCAAAGTTAAATTTGCGC
GCGATCACTGGGGT