Description :
From Genome Similarity Track
Location :
contig_49:217861- 221680
Transcript NameFunction/comments
g8292.t1hypothetical protein

Sequence
3819 bases(100 bases per row)
CCGCAGCCACCAGAATGGCTTGGAGGAGCTGCGACGCAATTTCCTTGACAAGAATCATGCTGTTCTCGTCTTGTGCGAGCGCATACACGATTGGGCGGAG
GTTGTACTCCACAAGGAACTGGATGGGCGATGTATGAGACTCGAAAAGACTCTTGAGCATCTTCAGCAAGTTCTTGCGCACAATCGCCTTCGGAATGAGA
CGCAGTCGCTTTAGGATCTCCGTCACAAACATGCCGCTTCGTCCGAGTGCCTGGTTAAGCCTCACCGAGCGACTCATAATCTCCAACAGCGGCTCCAGTA
GGTTCTCTAACTCGGTGTCCAAAGCGTTGTGGAAGTACACCGTAATTTTCATCAGATTTTCTGGAACGAGCAAGACATTCTCCATCTTCACCGTGTCGTG
CACAAGCCAAACGCTAATGGACTTAATGGCATCAATTTGCCAGTATTTATCCTCCAGCAACTCCAGAAAAAGGGACACGCTGTCGTACGTCCAAAGGTGA
GCTCGTGCTGTAGGCGAGGCATGCGCCAGATCACACAGGATCGGAAGCGCAAACTGCTTGAGCGGACTGGAATTCCGGACCACCTTAATAAGCGATGGAA
TCACACCAGCCTGTGCGGCATGAGTCTGGCGGTTGCGATTAATCCGACAGAGATAATACATCGATTGGAGCACAATGTTTTCGACCTCTTTCCGCTTCGC
GTCTGAGATAGAGGGGCCTTCTGTCTCTTGTTCGTTTAATAGACGCACAAGTGTCGGGATTGCTCCGGCTCGGTCGAGTTTCTCGAGTGTCAAGGGCTCC
ATGCTCAGATTACGAATACACTTGAGAACCTTCAGCATGGCGGAAACAAATTCGTCCGAATGCCGTATCAACGGCAGCGACCCCTTGTTTTGTTCCTCGC
CTGAGTTAAAAAGCGGCAAAGGATGGATAGCTTCCAGTAGGCCTTCCAAACAGCACCATCGCACATATGCTCTTTCACCACAGCATCTCCTTGAGAAAAT
AGCACGAAGACATCACAAGTCTTGTGAAGCTCCTTCATTGTCCACTGTGCCACTGATCCACGCTTGGATTTGGTCGGTTCTGCGTTTGTTTTCAATAATT
TCGGCACACTTTCATCGCATTTCGGGGAGCGCGTATCGCTCGCTGACACTGACGCAACAATCTCCGAAAAGACGACGACAAACTTTTTCAACAGACCCGC
CTTCACAAAAAGACGGCATATATCGTTCTTCGGGATGGTCTGGATGCTGAACACGCTGAAGATTCCATCCAGAGCGACCCGAAGCGTGTCCACGTCGTCA
TTAAGATTGGATGGTTTATCTTCCAGGGTCAAAAAGTCCACCAATACGGGTAATCCGCCACACGCGATGAACATTTGTAAAGTGAGCGAGCTTGTTTTGC
AGCACTGCCGTACAAACTTAGCGGCTTCCATCCGCACCGCGATTGAGAATCGTTGTCCTCTGGGTTATCCATCCGGAATCCTCTGCCGCTTTCACCTGGC
AAGTAGTATGGGTTGTGCTGCTTCGTGAGCTTGATAATCACCGGCACTAGTCCAACCAGTGCCAAGTTCTCCTGGAACTTTTTGTTACCCTCGACAATCT
GCGGATGCAAGCAATAGCAATCAGAGTAAGTCGCACTATTCCAAACACAGCACAGCGAACAAACAGATCTTACGATATTGATAACCCTTAGTACGGCATG
CAGCACGTCCATCTTCTTCATTTCCAGCGCCTCCATGATGTTGGGCACCACACCAGGCTGAGACATCAAGTCCCGCCTCAGAGTTACGTTCTGATCAAAT
ATTTCTTCCTGTAGAATGGCACGCATTTAGTGAGCACACGGTATCAAACCCCCTCTCCATCGAAGATGGGCGTAGTGCAGGTTATTTCAACGTAACGTAC
CAAATTATTGCAAGCATCAAGGATGACCTGGTCTTCCATGCTTGGATCCAGTAACGAAAGTAGCTCTACCACTCGAGCTGTTGCCTTTTGGTTAGTGTCA
CGAGCAGTCGAATAATCGAAGTCCAACTCATCGTCAAAGAGATTCTCCTGCGCACTTCCCCCAGAAGATGACCCCACATTACTATCACGGTTGCCACCAA
CACGTAACACCAAACTCCCCGGTTGCTCTTCAAAGTCGAAGTCACCGTCGATATCAGCGTCCTCCTTGAAGTCACTGAGCCGTTTCTTGGCTGGAACTAC
TGTAGCACCGATAGGATCTGACTCCATAGCACGTTGTTGCTTCGCAGCTGCTTGCAAAAGTTGCTTCTCGTCAATATCATCAAATGTGAGGTCTTCTTCC
GGATCCTCGACAAACTGCTGTAGCTTTGCGATGCGGTTTTGAGCAGGAATAAGTGATGATCGATCCCACGAGTTCATCGATGACTTTTCGCCCTTACTCT
GATTCATGTTGACACCGCTACCACCGTGACTAGCATCCAGAATGGCTGAGTCCTCCGATAAAACTCTTGCTTCAGACCCCTCGTCATCCCACACATCGTC
GTCAAATAGTGCGTTCGCATCTTCTTTTGATAACTGGAACTTTGACTTGCTCGGCGCAGCTTCCACCGATGCTTTTGAAATGCTATCGTTCTTGTTCTCG
TCAGCTCTAAGCACGAACGGCGTGGGGTTAGAATCCACACCGAACTCATCGTCCCAATCCTCAGCATCCTCGTCGGACTGCTCATTTGCGACACTGAGAG
ATCGGTAGCTTTTGCCTGAAGTTGGCGGTGGGATGTCCGTTGTAGACGAGCTTTTCTCGTATAGTTTAATAGTATTCAGCACAGCGTCACGATCGTTGGA
AGAGGTTACGCTCTCTGCAACGAGCTGCGTACTTTGCTCCACCTTGTTTTTCGGAATCTGTGCGATCCACGGATGTGCGAGGAGTTCCTCTGCAGACGCT
CGCAGTCGCGGCTCTTTCATGAAGCACTTCATGATGAAATCGTGTAAGGCCTGCAGCAACAAACAACAAGTCAGCAACACACAGTTTGCAATAATAAGTC
AAAGTGTCTCTACCGGTGACATGCGCTGAGGAAGCGGTGGGTGGTCTTCTTGTACGATTCGAAAGAGTGCAGCCATGGGCGCTAGGTCGAAGTACGGTGG
CTTCATCGTAAGTAGCTCAATAATTGTGCAGCCCACGCTCCAGATATCCGAAGCAGACGACCAGCCAGCCATCTCAATCACCTCCGGCGCCACTACAACA
GCACACTTCATTAGCACGGTGCTACACAAAGTACCATTCAGCAGCAACGCACTCCAGTAGGGCGACCCCACAACTGAATTTGCCTTCTGCGTCTCGTTCA
GCTTGATCGCCACGCCGAAGTCGGCCAGCTTCACCAGTCCGTCCTTGGTCGTGAGGATGTTGGCCCCCTTCACATCTCGATGCAGCACACCTTGCTCGTG
CAGATACGCAAGTCCCCTCAACACCTGCGTGATATACATGGCCACGAGCGTCTCCGATAGTGAGCCGAACTTTTTGATAAACTGGGCGAGCGAGCCGTTC
TCCATGTACTCGAGCACAATGTACAGGTTCCCCTGCGTCTTGATCGTGTCGTGGTACTTGACAATGTTCTCGTGCTTCAATTTCCGCAGCAGACTGATCT
CGGTCTGGTATGTTGAATAATACAGGATAGAGTCGTCACACACAACAGCACAGCGCTAACACACCACCTCAGCTTGTACCTCAATCGACAGCAGCTCGTC
CTTGTCGATATCCCGCAGCGACACTTGTTTAATGGCGACGGAGCGTCCATTACGTAGATCCAGCGCCCCATACACGATACCAAAGCCTCCGCGCCCGATC
TCCGCCCCCATTGCTATGC