Description :
From Genome Similarity Track
Location :
Scaffold_71:21786- 24452
Transcript NameFunction/comments
Physo_139172putative polyprotein

Sequence
2666 bases(100 bases per row)
ATAGAAGCCGTCCGTCAGGTCGATGGCGCTATAGATGACGCTACCTGGCATGGAGTCGAGTACCATGTCCTTCCGCGGGATCGGGGTCTGTGTCGGGATG
GTCGCAGCTTATTGAACACGTGGACGATGCGCCAGCCGCCAGTCGCCTTCTTCACACAGAACGTGGGGCTAGAGTGTGGGGAGGTGCTATCGCGGACGTG
GCCAGCCAGGCGGCGCTTTTCGAAGAACTCGTCGATGGCCTTGACCTGGTCTCGCGGTAGTGGCTACTGCCGCGTCACGCAGTACTTCGTTCCGGGCGCG
AGGTCGATCTCGTGCCGAACTCCGCGGTCGGCTGGAAGCTCGGCGGGGATCTCATCAGGGAAGACGTCTTCAAACTCGCGCGCGGTATCGTAGACTGGGT
TACCCGACTTCTTCAGCGCTTCCCAGGACTGCGCTGCGAATCGCTCTTCGCGGGCAGACTTCGGTTCGGCACTCCTCGGCCGCGACGACGCGTCGTCACC
GCTGAGTGCGTGAAGACCCTCGGCTGTCCCGTTGGTCTCGGTGATCAAACACACCTGCTCGATGTCACCAGCCTTCGGATCGCGAAGGAAGTGTTTCCAC
GAGAGCCCGGGGAGCCGAGTGATTCCGCGAGCGTCGCGAGGTGGACTCGCGACTTCGATGACCCGCGTGCTCCGTCCACGTATTCGACAGCGCAGACAGA
TTCCGTCGGGGGAGGTGCGGTTTTAGTGTTGTTCCGTGGCCTGAGACGCTGTCGCTTGGATTTCCTCCTCTTCCTCCTCGAAGACCTCGAGCAGGAGCTC
GAGGTGGACGACTCGCTGGCACTGGACGACACATTGTCGCTATCGCTGGACGATACTTCACCCTCCTCTAGGTGCGGAGTGTCGAGCCCGTCCGCACCGG
AAGTACGCGGGAGCACCGCTTGCTCGACCGCCTTGTTGATTCGCGGGAGCCCACGTCGCTCGACCGCCTCGTTGGGGCGCGGGAGCCCACGTCGCTCGAC
CGCCTCGTTGGTTCGCGGGAGTCGCCTTCGCTCGACCGCCCTCGCAACAACCTCGCTTCGCTGCGAGGTTTTGGGTTCATTTGTCGGTTCATCCAACAGC
ACCGCACATGCCATACAGAGAGGGCCATCGCTCGCTCTGTGTAGGGCTTGCGTCGTGGATGAACGATCCACGACGGTAACGTGGGGCCAGTCCGTCGGAG
CGACCAGGAGATGAGTGAACACTTCACTCACATCGTAGTCGGCTCGACGCTTGACCGATCGGGCCAGCCAGTCGATCTTCGGCTGATACCGTGTCAGCCA
CGGTATGTCCAAGATGCAGTCGAACGCGTAGTTCATCTCGATCACCAGGAAGTCGTCGTTGCTACGGAAGCCGTCGAACGTGTACGGCGCGTGATATCAT
GCCGTGGGACACGGTGTGGCATGCCGTCAGCGAGCTTAATGAAGACGACGCCGGGACCCTCGCAGACGGATATGTCCGAGGAAAGAAGCGACAAACACGA
GGCGTGGAAGAAGTTGTTCGTTGCGCCCGAATCCAGGAGCGCACGGAGAGGACGCCGCGCGCCGGCGACGTGCAGGCTGACGATGATCAGTCTGTGGTCG
CCGCTGGTGGTGGTGGCATTGAAGTGTGCGTGAAGCAGTGGGGGCTAGGAGATCGGGTTGCCACCGGGGGACCCGGACCTCCGTTCCAGCCAGTAGGGCG
CCCCGCACTTACTGGTCCCGGTCGTTTTTTGTTGAACGGCCAGGAGCTCATCGTCGGCGCGAGCGACTGCAGCGTGCATCGGCGCAGGCGCGTGGCAGAT
TGCCGCGCGATGACCCAACTTCCCACAACGGTGGCAGGTCAGCGAACGAGAATTGCGGCCGCCGCGCGAGTAGTACCGCCGGTTATTCTTCGCGGCTTCG
ACGGCATCGATTTCCATTGGCTCGGGCATCGCTGCCCGAGTGTCCGACGGCAACTGTCGCGAGTACGAAGCGGATACCGTGTAGTCCTCGCGCAATGCGA
GGACGAACGCTTCTTCCAGCGACTTCGGCTCGGCACGCGTGAGACAGTAGCGCGTCATTCCTTCTCGCATGCCAAACACGAAGACGTGGACCTGCGAAGC
CATGTCGATGGGGCTCGTGACGATGCACGAGGCCAGGTGACGAGTCTTCTGTACGTAGTCGCGCATGGACAGCTTGCCATGCTTCAACGCGAAGAACGCA
GCACGCATCCGCGATTCGTCTTGCGGAGGCTCGAACGCAAGTCGAAGGTCTTTCTGGAGACTGTCCAGACTCGGGAAGGCGTGTTGGTCTACAACAAGCT
TGCCAAGGGCCCACTCCTTCGCCTTCCCCGACAAACGCAACAGGAGGAAGTTCACTTTCGCCGTCGGCGCCTCGATCAGTCTCGAGGCGATGGCGACGTC
GATCTCCCTGAACCAGCGGTTCAGGGGCAGTCGGTCTTGGCCGGCGCCGGAATACGTCGACGTCTCCATCTTCACCGCATCGTTCCTGAATGCGAGGGAG
TTGACACTCGCCGCTTGGCATCGGCGAGCTCGCGTTCCATGAACTCTTGGGCAGCCTGGCGTTGTTGGTCGGTGGTCGCTGAGCTCAGCAGCGACGTGAC
GACGAACTCGCCGGACACGGCAGCGAGGCGGTGAAGAGCTTCCCACTCAACCCGGGTGAGGTGGGG