Description :
From Genome Similarity Track
Location :
Scaffold_1150:2178- 4285
Transcript NameFunction/comments
Phymu_g12827hypothetical protein PHYSODRAFT_249657

Sequence
2107 bases(100 bases per row)
CAAAACGTTTAATTACTACTTGCCCTTTGTGGGTGCTGTCTGTTGACCGTCATTCGCTCGTTGTCTTGGCGTCACCCCACTCTCGATCCAGCGTTACAAA
ACCCGCGTGTGAGACGGAAACATTTCTGCAAAGGCTCACGGGAATATACTTAACAAGCACGCGTCTGCGGTCGATGCGCCGTGACTCGTTAGGTGGTTCA
CTGAGTTCCCACGGGACGTCGGTGAGGTTGTCCCCGTACGAGTGCGTCTCCAGAAAACTATCGATGATGTAACCAGGAAATACTATAGCCGCGAGGATTA
TACTTTACTACGGGCTTACTTTACCTGGGACACTGTGTACGACGAGATGCACGCTTACGTCGAGCAGATTCGTCTTCGAGTGAGGGAACCAGCGGGGTCT
ACCATGAGGAAGCTGTTGACACTGCACTGACCGCAGATTCGAATCCGGTCTGTGCGTTCAAACGTATGTGACGTGTGCGCCATCTATCAAGCCCGGATGC
GGAGCGGGACCACCGCAGGCGAAACCGAAGAGATGGGAGTCCACACGGCGTCTGCTCGTGAGATGCGGTACGTAATTCTCGCTGTGGATATAGATATCAT
TTTGATTCGAGGTATTGGCATAAGTATCATTATGTTTACTACGGGACATCTAGGAAAGCgcacaagaaggacaaaGCTCGTGTGGTTGCAGAGCAACCTG
ACACAGACGTTGCCGTTATTGTTATGGACTTCTCCCAGAACTTGACGGTGCCTTCGGTGTCATCGACACCATCGCAGTGGTACTTTACATCCCTCGTTGC
TGTGAACGTGTTCGGCATTTTCTACGAAAACGAGCAATTTCAGACGAATTATGTCTATGATGAGACCGTGAGCGGAAAGGGAAGTGACCAGATCAATGCA
ATGCTGCATCACTTTATCGACAACGTCGTTCTTCTAGGcggaaagaagaagctggttgTCTACGCAGACAACTGTGGAGgtcaaaacaaaaataaCCTGG
TCATTAAGTTCTTTCTAGCTCAAGTTCAGATGGGGGTATTGGAGCGTGTCGACTATAAATTCTTCGTGAAGGGGCATACGAAGAACTCGTGTGACCGGGG
CTTTGGGCATATCCGGAAATACATGGGGCGTCAAAACTGCTGGACGGTTAGGCAGGTGGTGTCGGCCGTGGAGAACTCGGCCTCGTTGAATAAAACTGTC
CACATCTCTCGCGACGACAATTTGTTTTAAGGGATACAAGCCCATTGTGTCCGAGCTCTACAAGAACCTAAGCGGCGTCCAACAGTACCAGTGGTTTGCA
ATGGATTCACTCAAGCCTGGCGTGGTCGAGTGCAAGAAGGGCCCGGGTGACCCGCTGGTTGAACATGATCTAGGTCGGAAGGTGGACGGTGTGTTCACTG
ATACCACTAAAGTGCTTCGAATCTTCACGAATTACCTGAAGCCTCTCGTTCCACCCGCGTTAAATCCCGAGAAGCGCCAGACAATGCACAGCGTGGTGCA
CCCATACGTCCCAGACGAGTTCCAGAGTGACCCTATCTACGAAGCGCCAAGTAGCCAGCAAGAAGTAGCGGCAAAAGCCGCGAAACAGATGCGCCGTGAG
CACCGAGCTGCTatggctgtggctgcgaaGGCAAATCAGAACAAACGTGGCCTAGACAACGAGAACGCTGATGCAGAGGCCCCtgctacgaagaagaaga
aataaTATTCACAAGGTGCGGCGATGTTAGTACAGTCTTTGGCTTTCAAAATGTTACTTACCTCCTTGGCCAGAACAGAATGATACTTATGTGCCATGCA
TGTCACTAATGTGAGTTTGAATACAAAACGTTAATTTTGAAGATCTTAGAGTTCGAATTTGATAATTCTGATGCTTTCATTAGCTCCGTAGCAAACTTTT
ATATCAGCCTAGCCAATAAAAAATGTTTTTATGGTCTGGGAAAGGAGATATGTTTTTCGGAGGGTGACAACTTTGCCCCACTTTGCTCctggaggctgtg
gaggGACTCAAAAGAAAGCCAAGACGCAGTGCTTGGCAATGGTATGCTTAAAAGGCGATTCGTACTTTGGTTGATTAGTATATTTGTGTTTGACGCAGTC
TCAGATG