Description :
From Genome Similarity Track
Location :
scaffold_1014:2178- 3829
Transcript NameFunction/comments
Pl_101564hypothetical protein PHYSODRAFT_504710

Sequence
1651 bases(100 bases per row)
CGATGAGCATGTACGGACGGCGACGGTAGCCATAGATCGGACGGCAATCAGATAAAATGCCGTAGAAGACCTTGAAACTCCACGGCAGCACAACCAACTG
CTTGGCCGCAGCGACTTGGGAGCCGGAACAGTTGAGGTACTGCTGCATGAACGGGTAGATTGTTTCGGGAAGCACACCGTACACCAGACCAACCACGGCG
TACTGGAACAGCAAACCGATGCAACCCCGGCTCAGCAGATTGGGCATGCCGCCAGGTCGAAGGGCGCCGCCTTCGTACTCGCCGTATTTCTCGACATTCT
TGGCGCCAGTGGTGTCGGGAGTCTTGATGCCCGTGTAGCCGCCCTCCTCAATGTCCTTGGCTTTGGATGTCGCGCTGCTGATGGACAGCCGCGCATCCAA
GTCGTTGGTGCTGGGTCCATTCACCGGCATACTTGCTCTGGAGTCCGGAGGTCTTGCGAGGAAGCAGGTGAAATGAAGAGTGAGTGCGTGATAGCGGTGC
AGTGAGAGATTAAAGCGTTAAAGCTGAAGGCTGCACGGACAAGCACGCCATGTCGACCCGCATCCGTGTCGATAGGTCAGCGCCACGCACGCAGAGCGGA
CGAACAACTAGCCGACGCTCGAAATCATGATGGGCATCGGGTAGCGTCGTCTCCTACAGACGAATTCTTGTGTCGGGCACCACTGCAACACGATGACAGG
CAGCAAGAAACGAGACGGCGGTACAGCGCAGGAGACTTTGGAGACCTTGGACCCCTTCTCTATTCATTTCAAGCGCAGCGCCGGCGCGCCCGGCGCACCC
ACCACAGTGTGGTCAACGGCACTAACGCTTACGATTTGCGCAAGCAAGCGGCAGCCCCAATGCACGCAAACATGTCAACGAAAATCGAGAAACAACGGAA
TATATTCATCTGTACAAACAGCTTTGGTTGCAACGGAGTCTTGCACTACCTCAAACGAGAGCACAACTGCGTCGGTACGATCTGCTGTGCGCTTAGCAGC
CGGTACCGCCAGCGATAATGAGGCACGACGTACTATCGAAAATGGCCAACACGTTGGTGACTATAGACCAAAGGATAGCGAAGGTCAAGTAGCCGACCGT
GATGCCGCCGATGAGTTTGCTGTGACCGCCTTCTCGGATCAGACGTTGCGTGTCCTCCTTCTGTTTGGGTAATAGGAACAGGAACACCCATGCGAATACC
ATCGCGGCATACATGATGATAATGGTGTACGTGATATCCATACGGACGGAGTGATCGTCCTGCTTCACGCGGTCGTTAGTGATGTTGAACGGACCGTCAA
CCAGCAGCGTCAGCGACGTAGCAAACGGTGCGGCAACGTTAGTCACCGTCGTGATCAAACCGTAGACAGCGGCTTCATTGCCGAGCTGTGCAAGTTCCAC
CGTCACGAAAGTGGAAATGATCCAACCAACTCCGTACGGAAGCTGCACAACAATGGGAGGACCCAACCAGAACCACTGGTTACGGAAAACATCCCATACA
ACAATCATTGCAACGGCGCAATCCATCACAATGACGGTCGCAGCTGTACAAACAATCATCCAACGCCAGTTCCAGTGGAGACCCCATTTCGACGTGATCA
TGATACCAAACATGAAGAGCAGATTGCTGAGGATATCGCTCACAGTGCTGT