Description :
From Genome Similarity Track
Location :
Scaffold_725:2178- 3244
Transcript NameFunction/comments
Hyaar_Emoy2814474hypothetical protein
Hyaar_Emoy2814475hypothetical protein

Sequence
1066 bases(100 bases per row)
CACTAGAAACGGTCCATGCCACGTATGTGCTAACTTGCGAGTGTAGCCGTCGTTGAACCGATCCAAATAGAGCCAAACCTGCATCCCNNNNNNNNNNAAT
CTCCTAACGGACAATTCAGCAACTCAAAACGGTCCATGCCACATATGTGCTCACTTGAGAGCGTAGCCGTCTTTGACTCAAACCAAAAAGAGCCAAACCT
GCATCCCGCGCTCATGTTACATGATTCCTGATTGACATTATGCTGATCTGATCGATCTCGGATCGTGATCTTGAGACGTTCGTTTNNNNNNNNNNAACGG
TAGGGTTGCCTTCAACATTGATCTTGGATCCCAGCCATGGATCAAAAATAATCGGGGTATATCCACGGACGCGATCTTGTGCCGTATTAATNNNNNNNNN
NGCACTATATGCTACACTATTCATGATAGCCATTATGTTGATCCGCTCGATCTCGGGTCACGATCTTGAGACGTTCGTTTACCGTCTCTCTTGCTCTTTG
GTATTGACGATGGATGTTATATAGCCATTTTCGAAGGTCGACATCGCGTGTTTTAGTACTCCCTAACGGTAGGGTTGCCTCCAGCATCGATCTTGGATCC
CAACCATGGATCAAATAAAACGGGGTATCTCCACGGACACGATATTGTGCCGTGTTCATGGCGAATGTCAGTCTTTCCCCATATTCATCCCAATCCTTTT
GATCCACGTCCATGACGTACACCTTGATCGCTCGAGTCAACGTATGCACCATGCGTTCCGCAGTTNNNNNNNNNNATTCATCCCGATCCTTCTCATCCAC
ATCCGTGATACATCTTGATCTCTAGATTCAACCTCTGCACCATGTGTTCCGCGGTTCCTTTCTCTTGCGGTCGGTAAGCTATNNNNNNNNNNCGTGAAGT
TCACGCGTTCGGTAACATGACGCTAGATACTCCGATAAAGAACTCTCCAATAAAAATGGTCCGCTAATATGTCCTCCCGATCTCTTGGTGACCACCTTCA
AAGCTCGTATGTCAATGGTGCATAAAGTCCTATTGATACAATTCTGGTACAACTGGACGGACCATC