Description :
From Genome Similarity Track
Location :
scaffold_41:217739- 220621
Sequence
2882 bases(100 bases per row)
ATGGATTTAGCCTTCCCACATAAAATGTAGGACTGCATGTAGGGATGGCTAATGCACACACACCACCATTGCTTTCACCACCTTGAACGGTCCAATACAT
ATTGGTAAAAGCTTCCTGCTTTCCAAGTTGGATACTGCATGGTCAGGCAGATTTGTAGCGTTAAGTAGTACAAGATCATTGGCCTTACATACattcttgt
tcttccttcTGCTCTTCTCTGCTTGTTCTTTTTTGCAGATCCTGAGCTTTCGCAATTGCGTCTCGAACTGACAGAACAACGGCTTGTCTCTTCACAATAA
AATCATCGACGTGCTGTTCGTCGCGACTTGTCATGCCGTCTAGAGGTCACATTGAGTCAAAATTCGCTTAAAACTCTGTGACAGTATTTAGATCTGACTG
CGGGTCTATAGCTATCGCTCCTCTCCAACTTATGATAAAGGTACTATAGGACAGGTACTATAAAATGAACACAATAGTTCACACAAAATGGCGAATGACC
CGTCAGGTACTATAGGATGAACACAATAGTTCACATAAAATGGCGAATGACCCGTCAAAACATGCGTGGAGTTGTTCAACGCAAACTCTGCAAGAGGGAG
AAATTCACTCCATTTCTTAAACGACGTAGCGTAACTACGCAGTATGTTCTCCAAGACTCGATTCAAACGTTCTGTTTGACCGTCCGTTTCAGGGTGTGTT
GCTGTTGAtatgcacaagatggtgcccAATTGTCCTGACAGTGCACGCTAAAATTTCGACGTATAACGGGTGTCACGGTCAGCCACGATCTCAACAGGAA
GGCCATGCTGACGgaaaacaccgtcgacaaAGACTTTAGCTGTCTTCTCGGCAGAGATCTTGTCCAGAACaggcgcaagatgaaccatcttgcttaaTCG
GCCCACTAACACAAGATGTGTGTCACGTGGAAGTCCGAATATGAAGTCTCTACTCACAGAACCCAGCTGTCAGTTGGCACTACCAACGACTGAAGTGGGG
CCTGAGTGGAACCCGATGTTTTCACTCTCTTGCATAAATCTCACATTTTTTCACATACTTGCGCACCAACTTATACTAGTGTGGCCAATCGTAATCCTGA
GACAGACTAAGAAACGTTTTCTAACGTCCGGAACGGCCATTCGAAGGGCTGTCATGGTGCTCATATAAGAGGCGTTAACGCAAACCTTCGTCATCTGGAA
CAACAACTCTTGCCATATCCCCATGTTCAGCCACATAGTACAACAATCCGTTGTGTACCCCAAAACGGTGAACACGCGATCTTGTGCGAGACGAACgacc
ttgcagtgctttgtcggaaGGGTTACTGAAAAACCTCAACAAGTCCTGACATGTCTCGCCAGACTTGTGCccttcgacaatttcttcgcgCACTGTAGTC
TTTGCTTGCACTCTGATCACCTGAATATCTTCATGACTCGTGCATATTTTCGATCTTGGACTTTGAATCATAGTCCGGACgtcttgacaacgcatcggct
AAGATGTTCGTCCTGCCTGGCGTACAGTGTACAACAAAATTGCactccgcaaagaagaaagACCATCGAGCGATAATTTGCGATAAATGAGGAGTCTTTA
CTGCCGTACGCAGTGGggtatgatctgtatagattgCGAGCGCTCGTCTCCAAGCAAGAACACGGAGCTTAAccaaagcatacttcattgttaGAAGCTC
TTCGATTGAAACTGGATAGCTTCGTTCTGCGGGCCGGAGTTGTCGCAACTGACACGAAACAACTCGCATTCGACCCTCATCATCGAGCTGCATCAACGCA
CAACCGATGGCATAATCACTTGCATCACAGACCACATGAAAGGGCTTATCGTGACAGGAGCATCTCTCAAGCTCTTCTGTACTTCGGCAAATACCGCCTG
GTGATTGTTAAACCATTCCCACTCAGCGTTCTTCTTTAAGAGTCGATAGGGGTTGCGCCAACGCTGCATAGTTGCGCGTGTATCTGTGCAAATATTTGAC
CAAGTCCAACCATTCTCTCAGCTGTTTCCCATTGTTTGACACAGGTCAATTTttgatagctttgactttctccGGATCTACATGAACGCCATTCTTACCC
TCAAAGCAGCCAAGATTGCCGATCTCTGGTGCAAAGAAAACGCTCTTTTTCAGACTAGCGTAGGAGTTATTCTCTTGCATAATTTGAAAGATCTGACGAA
GATGTTCAAGAGAAAAATCGACATCACACTTCTCATCCGTTTTCTTACTATGAAAGAATATATTGTCAAAGTTACTCGGTGCAAATTCTTTCAatggacg
aagaagattcATGACCATTCTGTTGAAAGTCGCGGGGGCGTTCTTCAaaccttgtggcatcactaACCATTTTCACAGCATACCACTGGGGTACTGACTG
CAATTAGTGGTGTATATTTCTCGAGCATTCGTGTCtgatacaaaaaaaattcagaTCGATTCCATACTGCCATCCACTCTATCAAGAATCTTATCCTTGC
GTGGAACCGGAGTCTGGGCAGGTATGATCGCGTCGCTTATTTTATTGAAAAGATAAACAATGCACCAGCCACTTGTGGCTTCTCACACAGAAGGTTGGAC
TACAATGCGGAGACTTACTCTTATCCACATGACCAGCCTTTTGTCGCTGCGCAAAGAAGTTGTAAATTGCAATGCTTGTTCTTTTGGAACGGCCACTGCC
GTGTGATATATACTTTGTACCAGGAAGTATGTCAACGTCATGATGAATGCCTCTGTCAGATGCCAATTCGTCCGGCACCTAGTCTGAGAATATATCAGCA
TATTCCCTGACAAGTTCATACACGAGGGTTTGAGCATAGAGCATCCTACGACTGCGCATCAAATTTTTTCCTCGGTGTCTTC