Description :
From Genome Similarity Track
Location :
Scaffold_75:21750- 22960
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_75-snap-gene-0.9GK14801

Sequence
1210 bases(100 bases per row)
CACGTTTACCACGACGATGCGCCACTGTCGCGAGGTCGAGCTCATCCAGACGTCGCTCAAGTCGTACCACGTGCTCGCGACGATCGCCTCGCGGCTACGC
GCCAATCTGACGGCTGCGGCCGAAGCCACTGCCAAGTCCAATTTTGCCCTGTCCACCCAGTACGAGGCGGCGTCCAAGAAAATGGACGACGTAGCGCTGG
CGTGCTTCCGTGCGCTGTGTACGTTTTCCTTCCCATTGCCCGAGAGCGTCAGGGGCTCGAAATCCGGTGGGTCGAGTGGGGGAAGCTCCTCCACGATCAA
TGGATCGTCGGGGACCTTGTCGTCCTCGGGCAGCACCGGCGCGGGCGATTTCCATCCCAGCGACAATGACGAAGAGAGCGAGTCGTGCGTCGTGGTGCTC
ACGTGGCGAGAGGTCCACGCCATGAAGGCGCTGTTCAGCGCCGCCCACATTATGCAAGAGGAGATGGTTGAGGGCGAGTGGTGCGGGTTGCTGAATGCCT
TCGAGATTATTGTCGGGCTCACGGACGGCAAAGTCAAGGCCGGGCAGAACAAGATCCCGACCAAGAACTACCGCATTGGCGCGTTCCGCGTCGAAGACGA
GGACGTCGAGCAGCAGCTCGTGATGCTCGGCAACTCGATCGTCGAGCTCTTTCGCGACGCACTGAAACTCAGCAGCAGTGCGCTGCGGCGGCTCACGGCG
GCGCTCCGCCAAGTGTGCTGGGACCAGCTTGGGCTGCCCCCGCATCTAGTCGCGACCACAAAGGAAGAGACGCTTCGCCGCCCGAGTGCGAACGTGATCA
CGACGGCCGACGACGACTCAGAATTGCCCAAAGTGTCGGCGACCCACCAGATGAAAATGTACCAAAACTATCTGGGCATTGGACTAGCCGGCTCGGGCTC
GTACCTCCCGAGCTTCGCGCTGCGCATGCTCACGCAGATCGCGACCAACAGCAAGCGGTGCTTTGAAGACGTTATCAACGAGCTGCTCGTCATGGTGACG
TATACTGTGCAGCCACCGGCGACGCCGACGCAATTTCCACAGCTGAGCCAGTTCCAAGTGGTCGCGACGGACAGCATTCTCCAGCTCATGCAGCGCGCAC
TGCAGAACGTGATCAACAGTCTGTCGCCCACGACCAAGCTCCCGAACGACGCGACGCTCGAGCAGATGGAGGCCCATAGCAAACTGTTCGAGCGAAGCGA
GCCGCACGTG