Description :
From Genome Similarity Track
Location :
Scaffold_3273:2175- 3400
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3273-snap-gene-0.3Drug/Metabolite Transporter (DMT) Superfamily

Sequence
1225 bases(100 bases per row)
ATGAACGTTGGTCGGATGCTCGGGGAGTCGAAGCTCACAGTCGTACTCGTGCTCCTGGTCGCGACGCGGTGCATGGAGCGCGTGCTCTACACGTACGTGG
CTATTATGATTTTTTTAAGCTTGTGGGATACTGCCGTGTATCGCTCGCGACTGGTGCTGCCAAACTAACAGTGTTGCTGAACAACCACTCACGATTATTT
TCTTCAGTCGCATCGCGTACGACTACAAGGCCTTTCTCTGGTACTCGACGTTCGTGAGCCTGCTGATTGCATTGCTCATCGTGTCGTGGCCGATCGCGTG
GTAGGCTGGTCTGCTTGAGCATATACTGATCGCTCATGGTGCAAGCTACTAACAAAGGAACTGTTGCTCTTCTTCTTCTCGTAGGTACAAGATGTACTTC
ACCAGTACGTACGAAATCAGTAACAATGCGCTTACCGTCACTGCACCAATGGCGATGAGCATGGCATAGAAAATTCACCTACCTTACTCTGTCGATTCGT
CCCTGTAGACGACATCACGCCCGCCATACGCCACTTCCCGCACCGCAAGTTCCTGATAATGGCGCTCTTTGACACGCTCTCAAATGTGCTCGGCACCTTT
CCGGCACCACACATCGAGTACGCCACGATCTCCGATCTTCCTGTCACTCATGCGGATGAACTATTCTCATGTCCTGACTCGTGTGTCTGTCTCTCTCGCG
TATATGACCTTGCAGTGGCAACCTTGTGAACGTGCTCGGACAGCTCGGAGTGCCGTTCAACATGGCGCTCGCGTGCGCGTTCCTGCACACGCGCTTCCGG
CGAGCCCACGTCCTGGGGGCCATGCTCGTGATGTACGGCGGCCTCGTGAGCATGTTCCCGATCTTGAATGGTGAGACGCTTGCGAACGCGCCCGACCCGA
GCGCTGGCTGGCTCGCACTCTTCATGGCGGCCCTGGTGCCCATCGCGGCCTCCAACATCTACAAGGAGAAGGCAATGAAGGACACGGAGCTGGACATCTG
GTACGCGGGCGCCTGGATGAACGTCTACCAGTTGCTCGTCGGGATCGCGTCAGTGTGGACGATCCGCATCCCGGCATTCAGCGACCCGCCGGTGCCCTGG
AGTGACTTCTTCGCGTACCTGGGTAAGGCGCACCAGTGCTTCCTGGGCCACGCCGTGGAGCTCAACGGCGCAATCGAGCTTTGCAACACGGGCGTGCTGC
AGACATTCCTGATTTTCATCGCGTT