Description :
From Genome Similarity Track
Location :
Scaffold_1588:2175- 3338
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1588-fgenesh-gene-0.0HECT ubiquitin ligase

Sequence
1163 bases(100 bases per row)
GTTAATGCGTAGTGAAGCCGTACATTTTTGTCTCGACGGTTGCCTGCAGCACAGCTTTCAGCTGGTTCCGGTCGACGTGCAACGGTAAATCCAACCGGTT
AAAGCACGCGTGGCTGACAATGTAGCCATCTTTGACCAGACGCACCCCCTTTAGTGTGAATGGGCACAACCGGCCGTCATAGCTGGTCAATGCACTGAAG
CCAGCGATCGGTACGCGCGACGAGCCGGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGTTCCCAG
AACCACACGACAGCCTGGTGACCATGTAGCCCGACCGTGTACCTCGTGTTGCGTTCCCAGTCGTCGACGTCAATCTCGTCCGAGCCGCAGAGCAGGTAGT
CAAATTCTTCGGGGTCAAACAGCATGAGCAGCTCCTGTGGAATCACTTCGTAAACTCCCTTCAGGAACACGTACAGCTGACTCGAGACGCTCTCAAATAG
CAAGTACCGGAATCTTCGCTCGACGTACTCGTGCTTGTTTTCATCCGTGACGTCGATATGACGACCATCTGGGATCAAATCCACGACGACTGCGTCATTA
TCACCGCGCGCCTCGGTAATACTGAAATCCAATCCTAAAGCCTCAGCACCGTCGTTCTCGAGCAGCCACAGCAGGTTTTGGTATAGCTCCGGATCGAAAA
ACTCGAGATCACGAAACGAAATCGGCAGTCCCAAGATCATCTTGAGCAGCGGCAACGCCAAGTGGAAGCCCAGCACATACCCTTCGAGCAGCGCGCGACC
AACGAGGCGACCAGATGCATAGTAATACCTCAGATGGTGTTCCCCCGCGTCATATTGCGAATTGCCGTTCAAGTAGAAACTCTGTTCGTCCTTGTTCACG
CAGCAAAAGAGGCCACGATCAGGGTCGACGAGTTGCTCGTTCACGAGCATGAACCACTCGCGGTGCAATCCGCCGGCGTCGATCCCAGCTTCGTTGAAAA
AGTGGATTCGTATCGCCGTGCGGATATTTTCGATAGGCAACACGCAGATGGCGTCCATCGAGTCTTCAAACAGGTAGTCACGGTTCACGCTGATCTTGAG
ATTCTCGGACGATACGATCAACGCGGCTGTCGTGGTCACAAAGTGCGCATACTTTTTCGGGAA