Description :
From Genome Similarity Track
Location :
Scaffold_139:21749- 22854
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19594hypothetical protein

Sequence
1105 bases(100 bases per row)
TGCGCCAACTTCCGTGCGTATCCTTCTTAACACGATTCAAATACAGTTACACCTGATTTCATCTTTAACATGGTGTAAAGCTCGCCTTCGTTTTGTCGAA
CCGGTCCGACCTTGATTGTACATCATTGCGTTGTGTTGACCTGGCCTCATTCATGTCGGAGCTGATGCTGAATGTTGTGCACCATTTGCGGGCATCCCAG
TCGCGGAGGTGGGTGCTGCCCCAGCGATAGCGTCACTTCCAGCGTTGACATCGCCTCCCACCCATGTAGGAAGTAGAGCGGGGTGTCGCCTCATACACGA
TCGTGGGCCCTGTTGATGGAAAACGCCAAGCATTCTCCATACTCGTCTCTCAGGCTTTCTGATTTACGTATGCTACATACACCTTCAGGGCCCTCGTCAA
CGTTTGCACCATTCGCCACGCAGTACCGTTAGCCAGCATGCGGTATGCCATTGTCTCTGGCTTTCTCCTACGATGTGGTTGAACGTGTGGAAGAAATGAG
CCATGAAGCACGGCCTCGATCGACGTGTATCGCTTCACATGTGCCGAACCAGCAGAAGACGGAATCTTCGTTGGTTGTCTGCGCTGTCCCAACGCGTTAG
CTTTGACCGCCACGTAACCAGTGAAAAAAACAAAAACTCACCCATTTTTCAGCTCCGTGTTCCCCTTGTGCGACTTCGGTAGAGACGGGTGTGGCCTGTC
GCAACGTCCTAGCATGGGTACGTCGCCTGAATATTTTCTGGTGTCTGCTCTAAGCGGCGGACGTTCTTTCCCTGTCTCATAATCCGTACATTTTTTCACG
TGGCGATGGACACTCCAGAATAGCCAACGTCAGGTGAAAGTACGCTCATATTCTCTGGTACGTCCACCTGATGCACTAGTGACCTCCTTCCAGACTAGCG
AGATAAAGATGCAAAATATTTCTTACAGATTTTCCTGAACGACGTGCTTCCCAGCCAGATCACGCTCTTGGCCGAATTTCCTCGCGTGTGGACAGTAGAA
GAACAACCAGCCCTCCTCGACGGCGTAGTCATCGGTGTCCAGCTTCCCCGGTTCACGTGATAAGTATGTCTTCAGATCCACGATCCACATTTCCTTGTTC
TGTGC