Description :
From Genome Similarity Track
Location :
Scaffold_439:21746- 23875
Transcript NameFunction/comments
Phymu_g9924hypothetical protein PHYSODRAFT_535936

Sequence
2129 bases(100 bases per row)
TAGTCGACCTTGATGGACGCGTAGATCTTGCGCGTGAACCACAGCGAGGCACCGACACCCACGGCGCCCGTCAGTAGCGACAGCGCGCCAGAGATAACAG
CCATATAGCCGAAGTAGAGCATGGCGCCGATGAAGTTGGCCACGTCCAGACGCGTCCAGTAGTAGTACGTGGAGTAGAGGAACACGTAGCCGCCGCAAGC
GCCCGACACGAAGAACGACCGCCACCACCTGAGCATAGCGGCAGCAAAAGCATCAGTACCTTCAGTAGCAGGAGTTTTACAACCGAAACGTACCAGTTGT
AGTCTTCAgagcagagctggaagtaGGTGAGCACGATGGTGATCTCAGCGCACGTGTTGATAAGGATAAGGaaagccagcagcaggaagccGAACACGTA
GTAGTACTTGTCCGTCCATAGCGCcgacagcacgaagaagagctccacgaagATCGCACCGAACGGCAGCACACCTCCCACGGCCGCCGCCGACATGTGG
GTCATGTACCACGGCTGAGGAGGCACGGGGCGAGGGATGTTGCTCGTCGCCACGGGGAACGTCAGAGGCGCTTTCCTGTGAATAGCATAAACCACAATCG
TAAGCAACATTATCGCACGATATACACATTTCAAACCAAGCACACGCGTACCTGAAGCCGAAGTAGGCACCAGCGAACACAAGCGGTACCGAAATACCCG
TCCAGAGGAAAAAGACCAGCAGAATCGAACCGAACGGCACAGCGGCGTCCGAACCAGCGCCCCACACGAACAAGttcaggaagaagaagagcgagaacat
GATGCCCGGGAAAAGCACAGCCGTGAGCACCGTGCACATTTGCCAGCGCTTGCCCTTGAACATCTTGTACGTGCGAGCCGAGGTGAAACCGGCCAGCATT
CccagcagcacaaagcacaccagcagcgcgatcACCAATTTGCCACGGTTTGAGGGTGCCAGAACGcccacagcagcgaagaacaGCGTCACGAACGCCA
TGCCCAGCAGCTGACAGCCCGTGCCCACCATGACGCAGAACAGCATGGGGTTCTTCGACGGCGGGCGGAACACGTCAGCATGCACAAGCTTCCAGCCCGA
TTCCTCGCGCTCTTCAGCACGTTCCTCCTCGGTAGGCACGCGGTTGTAGCGGCTAATATCGCGGTGAAGGCTACGCATCAGAATCATTCCGACCATGCCA
CTGAGGAACAGCACGATCACAAGAGCATTGATAATGGAAAACCAGTGAACCTCGTCGCCACCCGAGCCGGCATCAAAGTATACATCCCACCGCGTACGCC
AGTCATGTTCATTGTCCAGCACCCACTCCACACTGTAGGTCCAAAACACGGGCatcttgccgtccttgttCTTGCGCACATACAGTGGGCGTTTAAGCTC
GCTGGAATGTTCACAGGCATCCATGCGGTTATTCTCTTCATCGTAACCCCTGTCCGCGTACTCGAAGCTGTACGGGATGACTTTGAAGTCGACAATACGT
CCCTCATCTTCCGAGGACTCGGCTGTGCCTAGAgggttgttgttgtagcCAATCAGGATTTTGACGTGGTTGTTGAGCTGCGgcaccacttccacttcag
GATTGAAGCTCCCCATTGGGAAACCAACCGTCATCCCTCCTTCCGACGACACGGAAGTGGCCGGAAGGTTGTCCAAAATCCAATTGATGCGGTACGAGTC
CTTGATTTTATTCTCCCACGTCTTGACATCATTCTCCTCGTATTCCTGCTTGCACAGTACCGTACACGCCTGTCCCTCGAGAAATTTGATCTCGTACGGG
GAGCTCTGGATGCGGTTGGCCGTCAGATACTCGCCCAAGTTCTCCGACTTGTACTCAATTTTCTCCGGCTTTAGAAAATCACAATAAGGAAGGGAAAATA
ATTAGACGAAACTCCCCTATACCTAATTGgataagaagaagaaaaaaacaaTGGCAACCTGGCAAAAGGGCAGCTTGTAGTAATCgagaggcagcagcgt
ctcggcCGACTTGAGACTGTTGACGAAGATAGGCAACGTCTCGCCCTTCGTGTACGTCGTCATCTGCACGCCTGGCAGCGAGAAGCCCTCGACCTCTGGG
GACGACAATGCGGccgcagccagcaccac