Description :
From Genome Similarity Track
Location :
Scaffold_139:21743- 22871
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19594hypothetical protein

Sequence
1128 bases(100 bases per row)
CACCAATGCGCCAACTTCCGTGCGTATCCTTCTTAACACGATTCAAATACAGTTACACCTGATTTCATCTTTAACATGGTGTAAAGCTCGCCTTCGTTTT
GTCGAACCGGTCCGACCTTGATTGTACATCATTGCGTTGTGTTGACCTGGCCTCATTCATGTCGGAGCTGATGCTGAATGTTGTGCACCATTTGCGGGCA
TCCCAGTCGCGGAGGTGGGTGCTGCCCCAGCGATAGCGTCACTTCCAGCGTTGACATCGCCTCCCACCCATGTAGGAAGTAGAGCGGGGTGTCGCCTCAT
ACACGATCGTGGGCCCTGTTGATGGAAAACGCCAAGCATTCTCCATACTCGTCTCTCAGGCTTTCTGATTTACGTATGCTACATACACCTTCAGGGCCCT
CGTCAACGTTTGCACCATTCGCCACGCAGTACCGTTAGCCAGCATGCGGTATGCCATTGTCTCTGGCTTTCTCCTACGATGTGGTTGAACGTGTGGAAGA
AATGAGCCATGAAGCACGGCCTCGATCGACGTGTATCGCTTCACATGTGCCGAACCAGCAGAAGACGGAATCTTCGTTGGTTGTCTGCGCTGTCCCAACG
CGTTAGCTTTGACCGCCACGTAACCAGTGAAAAAAACAAAAACTCACCCATTTTTCAGCTCCGTGTTCCCCTTGTGCGACTTCGGTAGAGACGGGTGTGG
CCTGTCGCAACGTCCTAGCATGGGTACGTCGCCTGAATATTTTCTGGTGTCTGCTCTAAGCGGCGGACGTTCTTTCCCTGTCTCATAATCCGTACATTTT
TTCACGTGGCGATGGACACTCCAGAATAGCCAACGTCAGGTGAAAGTACGCTCATATTCTCTGGTACGTCCACCTGATGCACTAGTGACCTCCTTCCAGA
CTAGCGAGATAAAGATGCAAAATATTTCTTACAGATTTTCCTGAACGACGTGCTTCCCAGCCAGATCACGCTCTTGGCCGAATTTCCTCGCGTGTGGACA
GTAGAAGAACAACCAGCCCTCCTCGACGGCGTAGTCATCGGTGTCCAGCTTCCCCGGTTCACGTGATAAGTATGTCTTCAGATCCACGATCCACATTTCC
TTGTTCTGTGCGTCACAATGCAAACCTC