Description :
From Genome Similarity Track
Location :
Scaffold_150:21741- 22931
Transcript NameFunction/comments
Phyag_g2762actin, putative

Sequence
1190 bases(100 bases per row)
TTTATCAGTATTTAAAGCGCGTTCACTATCAAAACTGCCTAGAATACTAAATTTATATACCCGCCGATTCATCGCTATAGAGAGTATCCATTGTCGCGCT
GggtccatctccttctccgcccCCTGTCGCTCCGCCCCTCAGGCAAGAGGTCAAGATGGCTCAGTTGGAATTTCGAGAGCTTCTGCGCACGTGGATTTAT
CAgataagaagaagaagaagcaaccATGGCAAGGAGAAACAACTCATGGCTCGAAGACCCCACGGCGcccgagcacgagcacgaccaCAGCGAccgccac
agcagcttccacagcaacagcctgCACTTCCCGTACGTCCGCGCCAGCAAGTCCCTAGACGAAATGAGTCGTCTGCGCAAGCTCACGTCCCTCAGCTACC
TCAGCGGCAAGGTTCGCGGCATGTTCCACCGCGAGCACCGTGACACGATCGTGtgcgaggacgacgaggagagtcccagcggcagcaagcgcaatATTTA
TGACATTATCCGGCGCAACGAGCTGTCGCGCCGCGCGTCCACGGGCTTCGACCACCTGGCCAAGTTCAGCGACGCCGTCCCCACCGCGCGCCCTGCCGCC
TTGTCGCACAGCGTGTCGCTCCCCGCCGAGACGAGCTACGAGCCCAGCAAGGAGCAGCGCTGGtgcaccaactgctccaAGTGTTTCCAGCGCGGACTGA
GCCGCTTCGACCAGTACTGCGGCCTGGACTGCAAGACGGCGCATCGCATGCGTCAGAATCAGTACTACCTGGCTGCGCAGTCGCCCTCGCTCATGTCGGA
GGGGGAGCTGGCAGTGCGCGCAGCGGCGACGCGTCCCCCGCCGCACTTTACGACGACTCGTTCTATGCGCGCCAGCCAAAGGCGAGGATAGGATGGAAAT
CAGGTAGATTCGGAGAAGAGGGGGGGAGGATATGAGCCGGTTAAGatggagaggaggaagagaaccCTCGCACACGGCACAGCAGAACACCGCGcgcaga
ggaggagaggcGTGTATGATAGagacgaaagaagaagaaagataaTGTTATTAAACTATTTTAACCACTGTTTGACACTCGATGCATGCATGCACGCTTG
AATTCTCTGCATCCAGCCGTCCCATCtcgttctgcttcatcgtcgagaGAAGAAGCTTCTCCTAGTCGTTCCCGTTCTTCATCAATTACA