Description :
From Genome Similarity Track
Location :
scaffold_476:21735- 23798
Transcript NameFunction/comments
g8676.t1hypothetical protein

Sequence
2063 bases(100 bases per row)
GCTCCGCCATCTGGTTTCGGTGCGCGACGCTCTCTTCGACCGACTTGCAGTTCTTCGAGGCCATGTGACGGTTCAATTGGTAGCGACACCCCTGAACGCA
CTGGCAGCAGTTCACGCAAAGCTGGATCGGTGGATCAGGCAACCCGTGGCAGGGCTTTCGAAGGTGCCGGCGAAGGTTGTCGGAGCGAGCAAAATCTTGG
TTACAAGCCGGGCGGTAGTAGTATAAATAGCAACAACCAAAACCCAAATTAGTTTATCCACAAAACAAATGTTCAAAAATTGGTAGGCTCAATTTTTTGG
CGCATGCGACTCACGACTGTCGCACCGGTGGGGCAATTCGCTTCTCTGCAATTTCGATAGCGAGGTCGTCACATTTTGTACATGCCAAAAAAGCGAAACT
AAAACAAAAATATTACTGTAGTACCGTAAACCACGGGTTCACCGCTTCAACGCAAAGTATGAAGTTTTTAATGTGTATCTCATCTTGTTGTTGTCTTCAG
GTCGTATGTCGTATAGCTCTCCGTCAATGTCAACACAATACTGGCCGCCGAGGACTCAATCGATGTCCTCCCGCCGGTGCCACTCGCGTAGCCCCTATTT
GTATCAGTGTAAATACACTTTCTAAGTACGCTCTGCTACTCGTCGTCTGCTACGTCTTCTCCGGCTGATTGGGAATGCGGGCTTCTTGTCCAAATGGGAA
GTGTGATCTCCTCTGTTAGTCTCGAAGTGTGCTCTCCTCAGTCGAATCGGAAGTGCGGCTCCAGGCTGATATCCTTCGCCAGCGTCTCTTCTGGGTCACT
CTCCACCGCTCGTTACTGGGTGCCAGCTGGGTGTACCCATAGAAGATCTTGTTGAAGTTGTCGTCGTAGTTGAAGTCGTCCAGGTGCTCATTGCTGCTCC
AAGACCTTGTTGCTGCTTCAATTCTCCAACCGTATTACCATACGGTTAGTGCAACATATGACGACTACCGAACGGACATAGACTTGTACATGTGACACCT
CGCATTTATCTTAGTTTTTGTTTTGCAAAAAGCCGGAGATTTTTTTCAAAAGCCGCAATGCCTGCTGCCACATTTTCGTGCAATGTATCCAGTCGCTTCC
TCCCAGAGATTCTCTTGGTGCCTGTGAACCTGTGAACGTGGTACCAGTGGGGGAATCCGTAGCAGGCCGCTTGTCGCCCGAAGTATTGGTGCGGCCACCC
ATCTCATCGAAGATATCCCTGAGGACTCGTAAATTCCCCCAGCAGATACAGGCCGTACGGAGATGACGATACCAAGCCATTTCATCGGCGTCCGCTGCGC
ACTCACTGAATTTGGGGTGAAGACCCTACCGTCGGGAGTTGCTTAGGTAGGAATCGGGTCGCCAGGGCGTCTTCAAGGACGTCCCCCAGTTTGAGTCGCA
GACAGTAGAGACGGGAGAGCTGCGGGACGACTTGTGGGAGTGGAGTTCGAGTTGCCTTCTGTATTGAGGTGTTGCGTAGGCTGTGGGGGCTCATTCCGAG
ACGGCATCGTAGGACGCTCCTCAGCAGAAGCCTCGCTTTGTGAAGCCGCTGACTCCGTTTTCCATCGCCCTCTCTTTTTGAAGGCCAGTCGTCGAAAGCT
GAGGAAAACACAGAGGACATCATCCCTTGGCTGGTTGCAATTGTTGCTCTCTCATTGCTGTTGCGCGTTTGTCCTTGGTTCGTGGACGTTGATAACTGCA
TTGCCATCTGGATCCGTCTCCTCAGGGTCGTCTAAACTCGATTGTCTTATCACAGCCTCTTCCTTTTTTTCTGCGCATGGTAGCGTCTTAGGTCTCCGAA
TCACATCCAGACTGATTCCCCACGCTTTGCGCAAGTCAGAGTCGGTCGGTTGTGACCCCTTATCGTTCATGACTTGTTATATGTGTTTGGCTTGGCCCTC
TCCACCATCGTCCAGTCCGTCGTCATATAGAGTTGCCCCAGCCAGCAACTCGAGCTCGTGATGGATCCGGTGTGCCAAAGCAATCGGCTTCTTTGTCTCT
GGAATTTTGCTGTTTACACCGTACGGCTTTGGTTTCCCGTACAAGCTCCCCAATTTCCGCCTA