Description :
From Genome Similarity Track
Location :
Scaffold_32:217303- 219054
Transcript NameFunction/comments
g6895.t1XP_009528133.1 hypothetical protein PHYSODRAFT_332774 [Phytophthora sojae

Sequence
1751 bases(100 bases per row)
TGGGTCACCCAGCACGCGGACTTCAGGAGCCATGTGCTGCCTCTATCGGGCGCGGCGCAGTGCCAACGACTGTGTAAATTGATCTTGACCGAGCTCAGGT
TGCAGCTGGACGTGTGCTGCTTGCACGCGCAAGGGCACGGGAATGTTCCTGGCGCACCGGTGCTTCTGAGTGCACGAGAGAAGCTGCTGCCACAGGTGAT
GAACGCCAAAGGGCTCACAAATGTGGCGCTGTATCCGCTCCATCGAGACGAAGCGAGGCGGCAGCTGACGAGGAGATGGGGTGCGCAGAGCTCGTTGGCG
CTGCCGCCGCTGGAGGATATTTACGCGTACTTTGGACCGAGGATCGCCATGTACTTCGCGTGGCTCGCGTTCTACACGAGGATGTTGCTGCTGCCGAGTG
TCTATGGGGTTGTCGTGCACGTCCTTGGCATGCTGAATTTGGCGCCGAGTTATACCGTGCATTGTGTGCTGGTGGCGATTGGGACCTCTCTGATTGCGGA
TATGTGGCGTCGCCGACAACGAGAAGTGGAATTTACGTGGGGGTATGACGGTGTGTTGTCATCGCTGCACGCGACAACGCGGATGCAGTTTCAGGGCGAG
TGGATGCAGGATCCGGTGACTGGTGCTCGGTGTTTCGACTTCCCGCACCACAAGCGGCTTCTTCGGCAACTTTTGGCTGTTCCACTGCTGGTGTCCATGT
GCTGCTTGGTTGGTGGCTATGTCATTGGACTGCATGTGCTCTCAGAGCGTCTACGAGCGAGCTATAGTGAAAGCTGCACCCAGGCATGGGCTCAAACGGA
GCATATCGAGACGGGTATCGCTGGTACTGGATATTGGAGTTACGTTGCTGATAACTGGATACCAAGTAACGACGCAGCAACGTGTGCATTCGTTTCGCAC
GGCCCTAGTGTGATAAATGCTGTAATCATCTACGTCATGGACAACCTGTACCAGTTGCTAGCACGGAAACTTACGGAGTTTGAGAACTACCGGACGCTCG
ATGAGCACGAAGCGCATTTGGTGGCAAAGAGAATGCCGTTTCATCTTGTGAACAGCAACGCGTCTCTGTGGTTTCTCGCCTTTTACGTGCGAAGGCTGGA
TCGAGTTCGTGAGCGTTTGTGGATTTTGCTGGTGGCAACGCAGTTACTCGACAATTTCAAGGAGGTAGGACTTCCACTCGCTGTGTCGGTGGGTGGGCAG
GTCCTTACCGCGGAGAATAAGCGACGCCGTCGGCAGAGTCTTGAGAGCCTTGAGAGCGACCTCATTGAAGAGAGCCACCGCCTCCTGCGAAAAAGCTCAA
TCCCTCAACTGAGAGCCAAGCGGGAACGGGAACGGGTGGATGTCGTTAAAGCTGCTACTGAGCAGCGGTTAGCACGTGTGCTTATGCAAAAGCGGCAAGC
TACGTACCGTGACTCCTTCGCGGACTACAAGGAGCTCATGGTGCAATTCGGTTATGTGACTCTCTACAGCCCAGTATTCCCACTGGCTGCAGCATTCGCT
TGGCTGAATAACACGATCGAGAGTCGATCCGACTTGCTCAAGCTTGTGAACCGACACGGCTACCAGCGACCGGTTGCCCAGCACGCACGAGGCATTGGCG
TATGGGAAAAAGTGCTCGTGAGCTTCGCAGGCGTGGCTGTTGTGGTCAATTGTGCGCTCGTGTGGACCTACGAGCTTGACGAGCTTCTGCCAACGTGGAC
GGATCTTCAGCGCCTTGCCTTCATCGTTGCCTGTGAGCACGTGATATTTGT