Description :
From Genome Similarity Track
Location :
Scaffold_279:2173- 10718
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_279-fgenesh-gene-0.0Phosphatidylinositol N-acetylglucosaminyltransferase subunit Q
Pytiw_DAOMBR242034maker-piw_contig_279-fgenesh-gene-0.1Ornithine carbamoyltransferase, mitochondrial precursor
Pytiw_DAOMBR242034maker-piw_contig_279-snap-gene-0.6Sporangia induced dynein heavy chain

Sequence
8545 bases(100 bases per row)
CGCAGGATTCAAGGTGAGCTTTACACTTGAATCATTGTCGATAATATATATTTCCTGTAAATATTAACAACATCTTTATTTAATAACTAACAGCTCAATG
CCCCGCTCGCATCGATCCTTGGGAACGGCATCCTGCTTTGGTTTGACCTGTGGGAGTACGCGCTCTCGCTGCTCATCGGCAGCGACGCTCCGTGGACTCG
GCTCCTGCTGCAGAGCTCGTGGGCCTGCGAGGCTCTCAACTTTGTGTGGCGCAACATGGGTGCGACACTGCAGCTGACACTGCTGGCCGACGCACTCACG
TTCTTCACGTGGAATTCGTACTGGGTCTACCAGTACTTCACGAAGCTCAACATGCTGCAGTTCGGGCTCTTCTCGTCGCTCTGGAAACTCTTTCTCGGCA
AGAAGAACAACGTGCTGCGCAAGCGCGTCGACTCGTGCGAGTACGACGTGAGCCAGGTACGCAATGGTTCATCCTGAACTGCCTTGGCTTCGTGATCTTG
AACGCTGATGAGCTCTCTGTTGTGTGTAGCTCTTGCTGGGGACACTGCTGTTCACCATCTTGTTCTTCATCGTGACGACCAACATGGTGTTCTTCGTGTA
CTTTGGGCTCGTGCGCCTTGTCATCTTCGCCATGCAAGCCGCGCTCTGGCTCCCCGTCGTGTGTCTGCGCGCCGTGCCCGTCGCGTCGTTGGTCTATCGC
TGGTGGCATCCCACTTTCTTCGTGGCTGGAGTGCGTCTCGAGACGTCTCGGAATCCGTTGGCTCGGTCCACAAATACGCTGGATGTCCACGATGTCGGCG
TTGGGAAGCAGCGGCCGAGCGACGTGCAAGCCCAACAGCTGATCCGCGAGGTCGCGGCGCGAGATTGGTCCGTCCCCGCCAGAGTTGAAGGAACACGAAT
CGCATACTTTCAAGTGGCGCCAATCGCCTCGAGCGCGTCATCGCTCTTTTCAAGGTGAGTGCGACCTTTGTATATCAGTGTCCACTGCTTGCCGTAGATA
TTTCTAACTTATGATGCTATGTCGTGGCTTAGGTTGCGCCAGTACAGCAAGGCTCTGTCGACACACTACGCTCTGGGCGCGGTCGTGCGCTCCTGGTTCT
TCGGTAGCCACATCTCGCCGGTTCCACTCACGCTCCTGTTTGAGAGCCTACTGGTGCTCAAGAGTGACCGAGTCAACACACAAGACGAAGAGATTTCCGC
TGCGGCTGCTAGTCCGATGGTCTCGCCTGTGTCAAAGAAGAATGTCTAGCTAACTCGTGGACGCTCGTTGAGACACATGCGTGTCATGTTCAACTTCACG
ACACCGGCGTGTTGACTTGCCGAGAAAGACACGCAAGTGGTAAGCGGCCAATGAACTACCAACCGTGGATGCCAAGTTGACGAAGCACGCGATATATAAG
TAGCGAGTGTGTGACTTGGAGACCGCTTCTCGCGTGTAGCCATTGTTGGTTTGCTCAAGTGAGCTCTTTGATAAAGGAAATCAAAATCTATCTTCGAGAC
GCCTTAGGAGCAGGAAATCTCCCAGTTCATCGTCGTCAGGATATCTTGGTGAAGCTGCATTTTCATGGTCTTGAGATTTCTGGTGAACTGCTGGATGACG
ACCACAAGAAATCTCTCGCTGGGAGTCGTTCGGTACTATGCAAGACATAATAATTATTGTGCACCAAACTTGAGCATTCATACTATACATTTTCTTATTT
CAAGTCTAGAATTTTCTCAACTGTTTTCTAATACGATTGTGTCTCCGTTTCCCATTCATAAATCGAATTTTGCTTTTGAAAATATTTTTAGGCGTATAAT
TTTGTTTTGGCGTATAAAAATCTTTTTGGCGTTGCGCATTCATCACCTTCCACAGCCACATTCCGCAATTTCCCAAGCAGCACCGACACTCCACTCGACG
ACGTGCACTAAGCGAGCAGCGATGGTGTTCCTCATGCGCAAGCTCGCCCAGGCGGCCACGCTGTCCACGACCTCCAGTAGCAGCGTGCTCGCTCGCCGCG
GCTTTGCGTCTGCGACCGACAGTGCGCTCGCGTCGCTGCGCAACCAGAGCTTCTTGTCCACCGCCCAGCTCTCGTGCGTCGCTCATTCTGTGCTTGCTTG
CTTGGCTGCCTTTAAGCATTTATGTTGATGCGTCGTATCTGCATGCCATGCGTGGTTTCCTGACAACGCTTTGATGAAATGCGCTATCGACAGGAAGAAT
GAGTTTGAAGCCCTCGTGACCAAGGCGCAGGAGTACAAGGCGCTGTACTCAGACCCGGCGACGAAAGCTACTACGCCAAAGGTACGTTCGACAGTAGACT
GAGCTCGTAGCTTTGATTGTGTGCGGCATTATGTCTTACCTCGGTGTGTTCATGTCGTTATTATGTAGCCACTTGCGGGTGAGATCTGTTCGATGATCTT
CCAAAAGCGAAGCACGCGCACGCGGTGAGTCCGGAAGCCAACATTGTGTTGGTAGTTCAACGAACGAATGCTAACTGTGCACGGATGGTTGTTTTCATGC
TGGTGAATAGCATTTCGAGTGAAGTGGGCATGCACCTGCTGGGTGGCAAAGCGCTCTTCCTCTCGTCGGACGACATTCAACTCGGAACGAACGAAACCAT
GAAGGTACAGAGAGAACTCTTCAGCTGACACGTCATTGCTTTTTGAATCAGTGACGGTCGTTCATCTGGTGGCACCTCATACTGTTTTTTGTTTTGTCTC
GACAATTAGGACACTGCTCTCGTGCTGTCGCGCTTCAACAGCATCATTCTGGCCCGCGTGTTTGGTCACAAGGATGTTGAAGAGCTCGCTGAGCTTGCCA
CCGTCCCAGGTATAAATCGCGTGTACTTTGTTATGATTGGGATTACCGGTGTTCATACTTCCTCAATACATTGGACTGTGTAGTGATCAACGCGCTCTCG
GAGAAATACCACCCGCTGCAAGCTTTGGCCGACTACATGACCGTCACGGTGCGTACGCTTGCGTCGCTCTCGTCTGTTGTTTCTCACGTGATGCTGACCT
AAATATGTTGCCACTCGGCTGCGTAGGAACACTTTGGCAAGCTCAAGGGCTTGACCATCGCATGGGTTGGCGATGGCAACAACGTCCTGCATGACTACAT
GATTGCTGCCGCGAAAGTTGGAGCGAATATTCAGATTGCCACCCCAGCTGGCTACGAACCAGACGCCGATGTCATTGAAGAGACCAAGCGCCTCGCGAAG
GCAAGTTGTCACACTCTTTGACATGGCTATTGAGCAGTCGATTTAACCTTTGACTCTTTGCTTTGCTCTTCATAGGAATCTGGCACCCAGGTCCTGCTGA
CCCACGACCCGATCGAAGCTGTGACAAATGCGAACGTCATCGCCACGGACACCTGGATCAGGTTCGCATCTCTTAATGCACTGAAAGATGTGTGAACATT
TCATCACTAACTTTTTCTTTTGCCGAACACTGGTGTTGCAAAATAGCATGGGCCAAGAGGAGGAGGCTAAGATCCGCAAGCAGCACTTTGCCGGCTACCA
AGTCACGAAAAAGATGCTGAAGAACGCGGCCAGTGACCACGTGTTCTTGCACTGCCTTCCTCGCCACGAAGAGGAAGTCGACGATGAGGTGAGCTTTGTG
ATCACTGTCGCATCCGTTTTCTTTTATTTGCCGACTAAGTCTGATCTCGTTTATCCTGAAGGTGTTTTACTCGGACAAGTCGCTGGTCTTTGACGAAGCT
GAGAACCGTCTGTGGACCGTGATGGCGGTGTACGCAGCCCTCTTGGGCAAGTTTTAAGATCGAATAACGAAGCAGCCCCATTGTCAATGTGGGCTTGCCA
AAATCTCACCCCCTCTCTATTGGTTGGTGTGCAGCGATGATCTTCCGTGCCAGCTTCCCCCTTCAAACATGATGCATGGTGGTTTTGGTTTTAGTGAAAG
GTCGTCGTATGGAGTCGCTACCTGGCCACTGACGAAGTGCTGCCTGCTGCTGAGGATTGGCCAGAAGCGAAGACTCGTTCAATTCAGCAGCAGCAACAAG
GACTTTACGAGACTGGTGGTTGACGGGAAGAAGAACACTGCGTGCTTTGCTGGCTGACTCTCCTTCGGCAGCATGGGGGACGAAGCAGGAGGCGCGGGCG
CAAAGAAGGAAATCAACGTATTCAAGTACATTGAGCAGCGCGTGGCGACAACTTTCCCGCAACTCGTGGGGCCAAAGTTCACCGCCAAGTACGCTACGGA
ACAAAATGAGTACGTGCAGCCTCGTTAGTTTTGTATCACATGCCATTCATGGTGAGGCACTGACCGATCATCTCTTCTCGTTCCTCTTAGAAACTGTATC
AAAGAGTTCCTCGAGTCCGAGGATATTCCGACGCTCATCTTTTCGGGAGACAACATCATTGCCGCGACCAAGATGCCGCCATCGCTCGGTCGTGGCAAAA
CTGTATGCTTCACTAAGTTCTACAAGACAGCGATCACGTCCAAGAACATTCAGACCGATATGTTTATGAACGAGATTACGAACAACAGCGTCGAGTACCT
CGAGCGGCTCATCTCGGAGATCTACTTGCCGCTGTTCTCGAACCCGGCGAACCAAGAAGGATGGGGTGAAGTGGCATCGAAAGAGGTCGTGGACAAGTTC
CACTCGTACATGGCGTCGGTCTCGATCATCAGTGGCGCCACAAAGGGCGAAACGTGTCTCCCACTGCCGCCCATTGACGGGAACGCGACCAACTTGAGCA
ACAAGATCTCGCTGCTGGAAGGCTCGATCGTGATCTGGACCAAACAGATCAAGAATGTGCTCAAGCAGGACCCAGAGGACCTCCTGAAGCAGGGATTACA
CCCAACTCCAGATGCCGAGATCGAGTTCTGGAAGCTGAAAGCTGCGAATTTGAACTCGATCTTCGAACAGCTCCAGTCGAAGAAAGTGCGCAAGATACTG
ACTGCGTTGGATCGCAGTAAAAGCACATACTGCACCACGTTTGCTCGTCTCTGCAAGGAGGTGTTCACTGTGCGAATCGAGGCGAACGACAACATGAAAT
ACTTGCGTACCTTGGAAGAATGGTTCGCTCGCCTGAACAACGACGAAGATTTCCCGAGTCTCACGGAGCTCTTCAAGCCCATGCTCCACATCATCTTGCT
GATCTGGAAGAACTCCAAGCACTACAACACGCCTGCTCGGCTTGTGGTGTTAATGCGCGAGATCTGCAACTCACTGATCAACCAAGCACGCAAGTATTTG
AGTGGTGAACTGATCTTCCAATTGATTGACCAAGATGAGGCTGGTATTGCGGTTGAGCAGCTCAAGACCACTCTCCAGGTCTGCAGCGCCTTCAAGAGCA
CGTACTTTGACTACAAGGCGACTGCGAACGCGGAGTGTCCTTCGAACCCGTGGCGCATTCAAGGCAATGCGCTCTTTGTGCGCCTGGACTCGTTCCTGGA
GCGTTGTCACGACATTCTCGACCTCACTCAGACTATTGTCCAGTTCTGTAAATTGTCCAAGATTGAAGTCGGGGGAACGAAAGGCAAGACGCTCACGCTG
AGCGTTCAGCAAATCCACACGGACTTCACGGAGGCTGTAAATACTTTCAAGCGCGTGTCAAGCGACATTATGGACGTCGGAGCATCCAAGTTCGATGACA
ATTTCTACGATTTTCGCTGTAAGATCAAGGAACTCGAGCGGCGACTTGGATCCGTGCTCACGCAGGGCTTTGACGACTGCTCGACGATCTTTGGACGCTT
CAAGCTGCTGGATTCATTTGAAGGTTTGCTGAATCGTCCAATCATTCAAGACGAGCTGGAGAAAAAGCACGTTGCGCTCGTACAAAGCTATGGACAAGAC
CTCAAACTGGTGCAGGAGCTCTTCTTGCACTGCCGAGACGCACCTCCGATCAGCTGGAACTTGCCGCCAGTCGCGGGAGCGCTTACGTGGTGCCGAGGGC
TCGTCGAGCGAATCGAGCACCCAATGAAGAAACTCAAGGAACTAAACCAGAACGTGATGGAGCGCGAAGAAGCCAAGGAGGTCTACAAGGTCTACGGGAC
AATCATTGCGTCTCTTCAGGAGTACGAGAACCAAAAAGTCGAAGAGTGGAGTCGAGATGTCGAGGCCTCGTCGCAGGCAAAGCTCAAGTACCCATTACTG
GTTCGCCACCCGCAGACCCGCTGTCTGCGTGTTAATTTCGACCCATCACTCGAGAAACTGCTCCGTGAGATCAAGTACTTGAGGTTGCTCAACATCGAAG
TGCCTCAGTCAGCGATGCAGATCTCTTCCAAGGAGGAGACCTTCCGCAAGTACCGCGGCGAGTTCATGTACATCGTGGAGCCTTACAACGCGATGATCGA
GGGGCTTCATCCACTCGAAGAGCCGCTTGTGCGCCGTCACATCAACAACATCGACGCTTGTGTCGGTCGCGGCATTGAAGAGCTCAACTGGAAGAGCAAT
GGCATTGACACGTTTATCGAGGAATGTCGCAAGGCTGTCGAGGGCGCGCACGAGATTGTGACGAACCTGAAGGAGAATTTGAGTACCATTCAAGATACTC
TTGGAGCCTGGAACATGCCATTGCTGGAGCGCCAGGCGAAACCGGTGGCTGTCAGCGAGCACGAGCGACTTCACAAGAGCTACATTGTCCAGCGCACACT
CAAGATTCGCGAGGGCGCAGCGGAGATTCATCGCCGCTTGAAGCAGTCGAATACGGGCATCGTTGGTGTGAACACCGCGCAGTGGAAGGCGTACGTGGAC
TACGTGAACAATATTGTCGTCAACGGTGTGGCGCGTGTCATCTGCTCGTCGCTCGAGTTTCTCGCAAAGCAACTTGACCCAAATGGCGGCAATGTGAGCG
CAATTGCGATCGTGGCTGGCACCGAAGGCGCAAGTGGCGGGAAAGTGTTGGCGGCCAAGGGCGATCGACTGCCTATGCTCGAGATCAAGCTCGACCTGAT
CGCGAATCGCGTTCAGTTCAACCCAAGCATCGGCGAGAACAACGGCAAAGGTCTTCGAGATACAATCCAGATGTGGGTCAACTCGTTTTTCAACGTCGCA
ACGGCTGTAAAACGACTGGACTCGGACGGTGGCGGCACGTACTTGAAGGAAATGCACTCGGACATGAACATCTGCATGAACTTGGCGACGATCAGCGAGT
ACCTTCAGGAAAACGAAGACATGCTCGCCAAGTTCAAGAAGAAGTACGACAGCTTTGCGTATTTATGGGAGTCGGACATGAACGTGAGCTTTCAGGAGTT
CTTGGTCACAGCCAAATACACGAGCGCGAATGGCACGGAAATGCTCAACCTGGAAGGTTTCAACGTCGAGATCACCAAATACGAGCAAGTGGCGACTGAG
ATCGAAAATCTCACGACGCCCACGGATGTTGGCTGGCTCAGGGTAAACTCGCAGCCGATCAAGACGGCCATGCTCACCTGGGTGAGCAAGTGGATCTACC
AGTACACCACGTACCTACACGAGCACGTTGTGAACAAGCTCGGTAGTCTGCATGGCTTCATGGACACTGTGTTGAAGGGACTTGAAGAGCAGGTTGCTGA
AAAGAACAAGGAAGCGCTCATGCGCGTGATGACACACATTCGCGATGTCCGCAAGCAGATGGACTCGACGAACGAGATTTTCGACCCTTTGCGTGAAGCT
GTTCACTTGCTCAAACTCCACGGAATCAACGTCGAAGACACGAAAATCGCAGATCATGCCGTCCAGGACTACTTGGAGGCCGCGCCCATGCAGTGGGAGG
GTATTGTGAACAAAACGTTCAAGAAGAAAGAGGAGATCATGCCGCTGCAGATGGCTGAAGTGGACTCGATCAAGGAAGATCTCGAGTCGTTCTACCTTGA
AATGCGCAAATTCCGAACCGAGTTCCGCACAAACGCGCCGTTCAGTTTCCAAGGCACCCCCGACGATGCGTACAAGCAGATGAGTCAGTTCGCCTCGGGT
CTGCACGAGAAAATGAAGCAGGCAAAGCAGTTCAATGAGCTCGAAGAGCTCTTTGAGCTCCAAGTATCGAAATACCAGGAGACCGTGGAGACTTTGTACG
AGCTGCAGCAGCTGAAGAAGTGCTGGGACCTGAAGGACCTGGTGCTTAGCACTTTTGACGACTGGAAGAGCACGCTGTGGACGAAGATCAACACCGATAC
TTTCGAAACGTACACGCGTGCGTTTATGAAACAGCTTAAGATGGAGGCGTCCGAGCATCAGATCATCAAGACGTGGCAGGTGTACAAGGATTCCGAGCAG
CTCGTGAAGAACATGTCGACAGTGTTGCCCTTGATCAACGACCTTCACTCGGAGGCGATGCAGGACCGTCACTGGAAGGCGCTTTCGAACATCTGCAAAG
TCAAGGTCATTGATCCAAAAGACCCGAAGTTCTGCTTTGCCGACCTCCTCAAGCTCAATTTGCACCTGCACGTCGACGATGTCGGTGAAATTGTCGAGAC
GGCCAACAAAGAACAGAAAATCGAAAAGAAGCTCACGATGATTGAAGAACTCTGGCGAAGACTCACTTTGGAGTACGTTCCGCACAAGGACTCGGGCACT
TTTGTCGTGAAGCCTTCGGAAGAAGTCGTCGAATCGCTTGAAAGC