Description :
From Genome Similarity Track
Location :
Scaffold_52:2173- 6477
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_52-snap-gene-0.12Endo-1,3(4)-beta-glucanase

Sequence
4304 bases(100 bases per row)
TGACAAGGCTATTCGCACGCTCGCTGTGATGCTCATGCCCAAGCTCGACCCCGTGCTCTGTATCCGGTTTGTCGCATCCACGTTACTGTTACAGGTCGAC
ACAACCACGTCCGGGCAGCTCGTAGCGTTCCTCTTCGAGTGTGCAGAACGACAGCAGACGACAATGGACGTGGCCAACGCGTTTGTCGACTCACTTTGTC
GTGGGGTGCCTCCACTAGCGGCAGTCAAGAGTCCGAGCGGTTTCGTGGAGAAGGCGTTCAGCTTCAATATAGATGGTGAGCACCAAGCATCTGTGCTGGC
CAAGTCGCGGGATGGCTGGTGCGTCCAAGTGAACCAGAACACCCAGATTGTGATTCTGTCCGTCCTCATCGGCAAAATATTTGGGGCCCCACGGGACACT
GTACTGGTGACCTGGTTACGGGAGCTCTCGTGTCTTGGATGGTTTGATGCGCCGCTAGCGGAGGTGCTGCCCGTCGTGACGATGCAGATGAGGGTGAGGA
CGAGTTGCAAGTGTTCGGCATCCATTTTGGTCACTAACGTTTTGTACGAACTGCAGACTGTGCAAAAACTCTCGGAAGAGATGCTCGAAGACGACTCGCC
ACGCACTGCTCGCGCGGTCGAGCATTTGCTGTTTGCCCGCTTGGCACCGAGCCTCGTGCTTCGCGTGATCCCTCGCTCAGCGTTTCTCTCACTTTACGCC
TCAAGCCCGTGCAGACTGCTGGAAAGTCACTTTGAGAGCTCGAAATTCTGGTGATATTGTTCTCTGTGCTGACATATCTGATTGTATAGGCCCAGGCTGA
TCATTCCAACATAGAAAATAACGTGCTTTGTGATCTCGTCCACGCGTTGTGGAATCAAGTGGTCGACCCCCTCGAGTACAAAGAAGTCAAGATGCTATCG
GTCGAACTACTCACCAAGCTACCACTCCACGAGATTGTCCCACGCGTGCTGGAGCAACTCACAGCATTTGCTAGCAGCCAAGGAACTCCGGCATCAGTCG
TAAAAGTGCTCACAGAAGATAGCATCCACTCCACGGATTCCGGCGGCTTTGTGACCGCGAAGCTGCTCGTGTACTATCTCAACCTCATCTTCACCGACGA
CTCGACTGACGCCCAAGACCTCATATTGATGGACAGAACGCTGAGCGTTTTGCTCACCTTGTTGAGTATGCCGTGTGCACCGAATGAAACGTTTTCGGCT
GAGAAGTCACCGCTTGTCGACTTGCAGATGGGGACCATCGAGTGTCTCTCGCTGCTGGTCACGAAGTCGATCAAGCATAAACGGAGATCGGGGGGCCCGG
CGGAGCTGCGGCTCGTGGAAGACGCCATCGTCCGACTGATTCTGTCGGGTTTATCGATCGATACTGCTGATCCGTTTCCGACTGTCACGGAAGTTGAAGT
GGGACAAGACGGACGTTTGCCCTTGTTCCAGTCGTGGAAGGCGGTTGTGCACGACACGTGTGGAGAACTCCACGACCGGCTTTCAGTGACCCAAGTTCGC
ATCTGCTGCTGCAATGTTCTTCTAAGGTAAGGACTTGGGATCTATTGAAGCACAATGGGCGTTTGGAATCTAACGGAAGCTCTGGAACTATCCCAATAGT
GCGCTTGGTAAGCTGGACGCTGACGGCACCTCCGCGTTTCAGGACCGCATACTCCGGACGAAAATTCTTCCGTCACTGCGGCAGCAGCAACTTCCACCAC
TGGTGCTGGGAGGGTGTTTACAGGTTCGTCTCGTCACCAATGGTGATTCGCATCGTACTGGATAGCTGATCCCTGCTTGTGCACAGATCGCGTTTACGTT
TTTTTTCAAGGCTGGTCCCTCGCTGCAACATGACGACCTGTCTGCGAGGGAAGTCACAAGCCTGGGCATCGCAGCAGTCCTCCAGATTCTGCAAGACTCG
GATAGGATGGCGGAAGCGGTAAAGCGAACGCTCGCGTTTCTTGAGGATCTCCACATTTTGCCGTTGGCTCACCTCTGAGTTGGATGCGTTAGGTTCCCAT
GAATGCACTCAAGCTGCTTGGTGCATTGGTTGGCAAAGTCCCGTGGCTCTGGCCGAGCTTGGCAGCAAACGACAGCGACACCCAACAAGCGATTGCAACG
TACGTTCACTTTACTACTAGCTGACCTGCCGTGGGGCTCAGCAAATTTTGGTTTTGACTTGTATAGAGGGTTGCAAAACACGCGAGACAGCGCGACGCCC
ACGACATCTCCGGCCGTACGCCAGCTCGCGCAGTCGCTTCTTCAGGCAATCACGTCCGGTTGATCGATTTCCCGCGACTCTCAGTTGTGCATTTTCGAGG
CCGCCATAAACAGCGCCCACGCGCGGCTCAGGCCGTCGTCCATCGGGCACTTCGCCAGTACCTCAGTGGCTTGCTCGGGCATCAACACGGCCGCGTTCGA
GTACAATAGCGAGGTCCATCCCGTTCCGTGCGCTTGCCAGTTCTTCACACAGTCCAGCTTGGCGAGGATCTGGTCCCACTCTTCTCTGATAAAGGTAGGC
GGGCGCACGACGTCCAGCATCGGCGACACGGGGATCATCTGAATGCCGTGAATACACTCGCGCGCGGGGTTGAACCACGTCGCATAGTCGCACTTGTTGT
CAAAGCAAATGCCCGTGACCTTGTTCTTGCCAAACGACGCCGGGTGGATTGTGCCGATACGGTCGTCCGCAATGAGAAAGTACGTTTCGATCGCGAGCGC
GTTCACCTTGAGCATGAGCTTGGCCAAGTTCTCAATAGGCTTGTGCTGCGTCACACGCCCGTACAGCGCCAGCCCGTAGAGGAAGTTGACTTCCTCGGAC
GTGCTTTCTTCGTCTTTGCCGTCGGCCATGGGCGTGACCCCGTGTGAGTACGAGTGGCCCAGGAACCAGTTGAACAGGCGGAAACGAGGGAAGAATGCAT
CGTCGACCTCGGTCGTGACGACGTCACGGATGAGCGTCTCAACAAACACGCGCAGCTCGGCATAATCCTCCGGTCGATGGTTCCCAGTCGCGGTCTCACC
ATCCATCTGAAGCAGCATCGCGGCGGCCGTGATGTAGTACCCATAGTGGTAGTGGTGGTCGTTGTAGACGGCGTTGCCAAAGTCGACGTTCATGTCTTTC
TTGCGGAGCGCCTCGCTGCTAATGATGCCTTTGTAGAGCGTGTCGTACACGAGCGGATACGCGGCCTGGTTCTTGGCAAACGCCTTGAGGATGTCACGCA
GTTTGGTGAGTCCCTGTTCAAAGACTGACTGCAACTCGGGGTTCGTCGTCTTGCTCAGGTGCTTCGCGACCAGCACCATGGTCGCAAACTTCTGGAGCGC
CTTGCCCTTGAAGTAGTAGCTGCCTTCATTCGGCAGGTCGCGATTCCAGTCAGTGTGGAGAATCTCTTGGGTCACCACCTCGGCAAGTCGCAGTTTCTGG
ACAATGTGGCCAGGGATATGCGTGCCGACGGGAAGCATCTCGGTCGCCTGGGCGTCCACGGCGTCGCTCGTGGCCTTGGGTGGCACGAAGCGCCACTTGC
TGCTGTTGCCGCGCAGCGTGTACGCCTGCATGGGGCCGCGCGTGTGCGACCAGAGCTGGAGCTCTGGTTTGCGGATCACGTAGGCCGCGTCCATCATGAC
CTGCAGGTGCGACAACGCAAAGTGCACAAATGAGTCGGCCGCGCACGTGGCGAGACGGACCGCCGGCGCCGACGCGTNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTGTAGCGTCCAGTCAAAGCCAAAGGCGTCGCCACTTTCCTCCGTAAACAGCGTCGCGCCCGAGGGAAACACTCCGGCAA
CGTTGCGATAGAGCACGAGCACCTTGCGTTCTTCGTCCGGGTCTTGCTGGCGAGACGCCTGGGACGACACGTACGCCGTCTGGAGGACGCCGTTGAACGG
CTGCGCCGTGGTCAGCGCGTTGTGCTGCATCGTCACGCGCGTGGTGGCGCCTGCCATGGCTACGGACGCGTCGGGGTAGTAGAACAGAATCCACTTGTGG
CCATTGTTGAGCACGATCTCGAGGGACGCCGCCGCGTCCGTCTCGACCACACCTCCTTCTTCATACTGCCGCCCGTTGACCGTGAGAATGCTGTGCTCCG
ACTGCACGGTCGCGTGGAGATTGCCGTGGTAGTGGAGCGTCGTGAAGGCGTTCCCCATGGACAGGTATCCGCGCATGAGCTGCGCTGGACTGGTCGCCGC
CGGACGATGCCCAGAGGCTCCCGAGAGCTGGAGCGTGCACCCCAAGTCATCCCACGACTCGATCTCCAACTGGACACCGGACGTGGACGCGGTCGTCCAC
TCGG