Description :
From Genome Similarity Track
Location :
Scaffold_1779:2173- 3716
Sequence
1543 bases(100 bases per row)
TCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACAAGACAAGTTTGATGATGGTT
CCCAAGTTGTATCTTCATAGCCCACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGTCAGTGGTGTTCTGTCGTCGAGGATGGCCTC
GACTTCATATTCATCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGGAACAGTTCCTCATCGAAGTCGAGTCTTGCTTTATTAGTCGCGTCTAGTACC
AACCGAGTGCTCGGTCGACTGTTGAACTCGTTGACAGCCTTGAGTCTCGCCACATGCACTACTGGGTAGAAGCGATACCCACTTCGGTCAGGCAGTTCCA
GCTCGTACGCAAACTCTTCCACGTTGCGCTTGATCCGAAAAGGTCCATGCCATCGGTGGGCTAATTTCTTCGTCAAGCCCGGTTTGACGCATTCCATGTA
CAACCACGCCCAGCTCCCAATCTCAAAAAGAGATCTCGGTGGGGCTCTTGCAGGATATTCCATCTCTTCTGAAGCTTCTAGGGGTTCCGCCGAGTGTTCG
TTTCCACTTGGTTGAGGTACAGCAGCTTTTTCCAGTCGACTCAGAGCATCATTTTGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCCTTGG
CCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTCC
ACGCAACGTCGACTGCGCATCCCAACCATGAACGAGGTAGAACGGTGTTTCCTTCCTTGTAGTGTCTTGAGAAGTATTAATAGCAAATACTAGCTTCTCC
GCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGACCCCATCACTGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTG
GCCGATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCGAATGCTTGGAAAACCTCGCTCATGAAGCGTGAGTCGCGGTCGTGCCTTATTAA
TGATGGGGCTCCGAATCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGTA
AACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTA
GTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCC
GATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGATGTCCTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGAATC
ATCGTCGTCGGTACCACAAGCCGCAGCTTGGTCTCCTCTTGCC